Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3795
Length(NT) : 801
Best Gene Model Blast : Link to GSTUMT00006671001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001539842.1| Score: 332 E_value: 3e-29
KEGG Definition: hypothetical protein
Accession: ang:An06g01390 Score: 314 E_value: 2e-27
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 111 E_value: 3e-06
PFAM Definition: Tim17, Tim17/Tim22/Tim23 family. The pre-protein translocase of the mitochondrial outer membrane (Tom) allows the import of pre-proteins from the cytoplasm. Tom forms a complex with a number of proteins, including Tim17. Tim17 and Tim23 are thought to form the translocation channel of the inner membrane. This family includes Tim17, Tim22 and Tim23..
Pfam Number: pfam02466 Score: 118 E_value: 4e-07
Swissprot: P25710|NUJM_NEUCR
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane
GO:0008137 = Molecular function: NADH dehydrogenase (ubiquinone) activity

Sequence:
>Contig3795
TTGGACTTCACCAAACATCTGAGCTATCACCTCCATCACCATCAATCTCA
ATAGTACCTCCCCCCCCCTACACCAATTCCGAAAAGAAAAAAAAAAAAAC
CCTCTCACAAACACTAGCATCACAAAAACCAGGGGGAAAGCAAGAAAGCA
AAAGCAAAAAACCAAATCACAAATATCAGACCCCGCCAAAAAATGGAAAC
CTCCTCCACCCCCACCTTCCACCGTCAAGACGCCATATCCCTCGGCGTGA
GGGGCATACTCTACGGCAGCGGTGCGGGGGCCTTCATCTCGGCGATGCAG
AACACGCTCACGAAATCGCCCGTCGGCGCAGCCTCCTTCATCACCCGCAC
CGGCGGCGTGATCGGCCTCGGGGCGGCCATGGGCGGCTCCTACATGTTCT
TCCGCGCTGCGAGCGCTAACCTGCGCGGCGTGGACGACAGCATCAACCCC
ACCGTCGGGGGCGCCGTCGCGGGTGCCTTGCTGGGGATCCGGGTCCGGAC
GATGCCGGGAGTTGTCGGGTGCGGGATCGGGTTGGGCGTCGCTATGGGGA
TATTTGAGTACACGGGTGGGGCGCTAGGCAGGCGGTTTAGTGGTGACGGT
GGGGGGTGGGCGAGGGATGAGGTTGAGAGGAAGGAGGGTGTCAGGGCGCG
CACGAGACGGGACATCAAGGAGACTATCGGAGTGCTGGGGGAAGGGAGAG
GTATTTACGGACCCGGATGGGAGGAACGTAGGAGAGCGAGATTGACGGAG
AAGTATGGAGTTAATTTTGATGAGGTCAAGTAGGTGTTCGTAACGTGATT
G

Sequences in the Contig:

SY0AAA11YB16FM1 SY0AAB43YO04FM1 SY0AAC16YP02FM1
SY0AAD10YE14FM1 SY0AAD48YC09FM1 SY0AAD48YI21FM1