Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3791
Length(NT) : 763
Best Gene Model Blast : Link to GSTUMT00002655001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_12911
Accession: ref|XP_001548516.1| Score: 196 E_value: 1e-13
KEGG Definition: hypothetical protein
Accession: ncr:NCU02015.1 Score: 189 E_value: 5e-13
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q7SFL7|ERFB_NEUCR
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>Contig3791
TTGGTCCTCCTTGACCCTCTCCATCTCTTTCTCTTTCAATCTCTTTAAAC
TGTCGCTCCTTCCGTCATGGCCTCCCCGAGAGGCTCACCTTTGTCCGCTG
TATTTCTTAATTCTCCGACGCACGGCGCCCTCCCCCTCTCCCTACACGAA
ATCAATGAGGACCAACCCGATGGAGGAGCGTACAGCGTAATTTCCTCTCG
GATGACCGATGTTAGCGACAATGCCTCCGACATAATGGGTCTCGCCGAGG
CGCAATTATCGCAAAATGCTTCTTCTCGCCCGTCTTCACTTCAACCCGGT
ATAGGACGTGCCAATACCCGGGTCTCTGTAAGCGATCCACAACCCGACGC
CTTCTCAACACGACCCAGTACGGCTATGTCGACATCTACGGCTGCGAGAG
GATGGTCAAATCCTCCACCTTCTCGCAGAGGTTTATCGTCGGTTGGGGGA
AGTCAAAGGGGTAGACCGTCATCATCCGCGTCGAGAACTCATGCTCCATC
GTTGACAAGTCACGCATTTTACCGACCAATGAGCTCAACAAAGCTGCAAG
CACAACGGGGGAAAGTCACGGAGGAAGACGAGGCGGAACAGAATCGGATA
CGGGGTTTTGCGCAGGCTGCACGGGGGGTTTCCGACAGGCCCCCAGTATT
GGGGTTATCAATGCATGAACCGATGATACATCAACACCTGGTTAGCGATG
ATCGGGCCCAATACGTCCAGTCAGGCTCTGGATCTCCAACTGGTCACACC
ATGCATACGGCTC

Sequences in the Contig:

SY0AAB45YF17FM1 SY0AAC16YN02FM1