Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3790
Length(NT) : 505
Best Gene Model Blast : Link to GSTUMT00007217001 E-value : 1e-129
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 149 E_value: 1e-08
KEGG Definition: hypothetical protein
Accession: ang:An04g04570 Score: 143 E_value: 4e-08
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 127 E_value: 2e-08
PFAM Definition: No Hit Found
Swissprot: O15084|ANR28_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig3790
TTGGGTTAATCCCGACCAGGCAGACGCCACAAACCGGACGCCACTCTCGC
ATGCCGCTCAGAACGGGCGTGAGGGGGTGGTAAAGATGCTTTTGGAACGG
AAAGATGTCCACCCCGCTACGCCAGATAATACAAACCAAACACCACTTTC
GCTTGCTCTCTCTAAGGGACATGATCGAATCGCAAGAATGCTCCGCGAAG
GGAACGGTGTCGACTCTGTGGTAGCAGCAGATCGTGTTGGCTAGGCCTCC
CTCCCAGCCTCAACTGGGTATGGGCGTGTGCGCTGTTCGTCCGCCACTCA
GAGGTGGTGATATTAACACCGATATCACAAATATTGATGGCCAGCATGCA
CTTTTTTCAGCAGACTCCGATTGGCGGGAACTGACACTGGACCTCAAAGG
CTCTCTTTACCATCCCCTGATAGCGGCCTCCTCTCTGCTGCGTTGTCTAA
GCTCTCTGCCCCCTCTCATGCGGCCCCTAGCCCTATGCTGCCTCCCCAAG
AGAGT

Sequences in the Contig:

SY0AAC16YM24FM1 SY0AAD16YO05FM1