Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3789
Length(NT) : 939
Best Gene Model Blast : Link to GSTUMT00001304001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein FG03920.1
Accession: ref|XP_384096.1| Score: 716 E_value: 1e-84
KEGG Definition: hypothetical protein
Accession: fgr:FG03920.1 Score: 716 E_value: 6e-85
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0254 Score: 310 E_value: 3e-29
PFAM Definition: Sugar_tr, Sugar (and other) transporter..
Pfam Number: pfam00083 Score: 348 E_value: 1e-33
Swissprot: P53048|MAL11_YEAST
Gene Ontology:
GO:0005624 = Cellular component: membrane fraction
GO:0005352 = Molecular function: alpha-glucoside:hydrogen symporter activity
GO:0005364 = Molecular function: maltose:hydrogen symporter activity
GO:0015574 = Molecular function: trehalose transmembrane transporter activity
GO:0015771 = Biological process: trehalose transport

Sequence:
>Contig3789
TTGGCGACAGATGGGCTTACAGAGGGCCTTTCTGTGTGCAGTTCTTTCTG
CCCGTGATGCTGATTTTAGTTATTCCTTTCGCCCCGGAGTCCCCATGGCA
CTTGGTACGCAAGGGTAACATCGAGGGAGCTCGCGCTTCTCTCATTCGGC
ATGTACTCCTCCGGGGAAGTAAATTTTGAATAGCACTATACTAACGTTCC
CCCTCCCGTCTTAAAGCCTCCACGGAACGGATCGTGACATCGCGCCGCGC
CTCGCGCAGATCCAAGAAACACTCCGCTTGGAAAACGAACTCTACACGAA
CGCCGCATGGCTGGACTGCTTCAAGGGCGTCGATGCTCGCCGAACAATGA
TAACAGTGGGCGTATTCTGCTGCCAGCACCTTTCCGGCATCATCTTTGTG
CTCGGCTACTCAACCTACTTCTTCCAGCTCGCCGGTCTCCCCACCTCGCA
GACCTTCTCCCTCGGCGTCGGTGTCACCGCGTGCGGTGTCGCGGGCAACA
TTTCCAGCTGGTGGCTCGTCAACACCGTCGGTCGTCGGATCGTCGCCTTC
TACGGAATGGTGGTGTTGACCGGCATGCTCACGCTCATCGGCGTCTTCGA
CGTCATTCCTACCGCTGGGGCGCAGTGGGCGCAGAGCGCGTTCACGGTCA
TCTACTCGTATGTCTGGTTCTTGACCATTGGAGCGATGGGTTATGTCATT
CTTGGAGAGGCATCTTCCCCCAGACTTAGGAGTAAGAGTGTTGGCCTTGC
GGCGGTGGTGCAGAGTCTTTGGGGGTTGATTATGAACTTCGCTCTCCCTT
ACTTTGTAAACCCCGATGAGGCGAACCTTCGCGGTAAGGTCGGATTCATT
TTTGGCGGCACAAGCTTGCTTGCTACGGTCTGGGTCTTCTTCTGCGTGCC
AGAGTTTAAGGGGCTTACCTTCTCGGAGATTGACGAGAG

Sequences in the Contig:

SY0AAA8YC02FM1 SY0AAC16YL22FM1 SY0AAD12YE07FM1