Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3787
Length(NT) : 664
Best Gene Model Blast : Link to GSTUMT00010517001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001211021.1| Score: 182 E_value: 4e-12
KEGG Definition: hypothetical protein
Accession: ang:An06g01210 Score: 180 E_value: 4e-12
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG3117 Score: 216 E_value: 1e-18
PFAM Definition: Sas10_Utp3, Sas10/Utp3/C1D family. This family contains Utp3 and LCP5 which are components of the U3 ribonucleoprotein complex. It also includes the human C1D protein and Saccharomyces cerevisiae YHR081W (rrp47), an exosome-associated protein required for the 3' processing of stable RNAs, and Sas10 which hash been identified as a regulator of chromatin silencing..
Pfam Number: pfam04000 Score: 146 E_value: 2e-10
Swissprot: Q8NEJ9|NGDN_HUMAN

Sequence:
>Contig3787
TTGGATCTTACCATTACCCACTTCTCAACACTCATCCACCCATCCTTTCG
CATTCCCCCATCTATCTATCTACGATACTTCTATCATACCTCTATAATAC
TATCGACAATTTCCCCATAAAAAAGGCCTGAAACCAACTTAAGCGGGACA
TCGCACACACAAACTGCACAATGTCTCCACCGCCAGATCTCCTCGAAACC
CTAACGACACTCACTGCCTCCCTCACCACGACTAGTACATCCATCCAATC
CGCCGAATTCCCGACACTCACATCCCCAGAGAACGGCATATCCCTCCTGG
GCCTGAAAAACGAGCTCCTCCTCTCATATGTCCACAACATCGTCTTCCTC
GTACTAGTCCGGCTCCGCTCGGGCACATTGAGCAATGGCATTGGTGCAGA
CGCAGTCAAGGAACTGGTCAAGATCCGCGTTCTGTTAGAGCGGGGTGTGA
AACCGCTGGAAGGGAAATTGAAGTACCAGATTGATAAGGTCATCGCTGCA
GCGTCATCGTCGATGCCGGCCGGTACCGCTCCTGCAACGACGAAGGAGGA
GATAGAAGTAAGAAATGGCAAGGGCAGTGGTGAAGATAGTTCAGATGAAG
ACGAAGATGTGACAGCAAACAACTGCGACTACTACCCCCTTCAGGAAAAA
CCCCGTTCAGACGT

Sequences in the Contig:

SY0AAB43YL03FM1 SY0AAC16YK16FM1