Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3786
Length(NT) : 1123
Best Gene Model Blast : Link to GSTUMT00007201001 E-value : 0.0
Numbers of ESTs : 28

Blast Results:

Nr Definition: Bax Inhibitor family protein
Accession: ref|XP_749457.1| Score: 807 E_value: 4e-84
KEGG Definition: Bax Inhibitor family protein
Accession: afm:AFUA_2G03220 Score: 807 E_value: 2e-84
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG1630 Score: 381 E_value: 2e-37
PFAM Definition: UPF0005, Uncharacterised protein family UPF0005. The Pfam entry finds members not in the Prosite definition..
Pfam Number: pfam01027 Score: 163 E_value: 4e-12
Swissprot: Q5XIA8|GHITM_RAT

Sequence:
>Contig3786
TTGTCCTTTCACCCTATCCGCAAATCAAGTACAAACAGCAAAATAACAAT
GTTTCTTCAGACCACCATCCGCCCCTTTGCAGGAAGGACTCTCTTCCGCT
CTTCGACGAAACCATCCACTCGTACCTTCACAGCCCTCCGTTCGCCCATC
CTCCGACAGGCAATCACCCCCGTCCGCCACCAACTCCCAAAGACCCAGTT
TGCCACAAAACGTTTCTTCACGGCAGATCCAGCGGTCGTCGCTCGTCCGA
CTAGGCAGCAGAGTATTCAAAAGCTCTTGTATGCAGGCGGAGTATTTGGC
GGCACCCTTTTATCGATCAATCTTTTGTTCAACCATGAAACCCGCCAGGG
CACCATTCCACTATATGAGCGTGCCTATCTGCAGGAAACGTTCACTTACA
CTGGTCTCGGGGTCGGTATGATAGGTCTAGCGGCGAAGGGCCTGCACAAT
ATGGGGTGGAGCTACCGGCTTATGAGCATGAACCCATGGCTCATCATCGG
TGGCGGCCTTGCTGCGTCAGTGGGGACAATGTTCGCCACTAGGGTTACAG
ATCCAGACAACTACATCCAAAAACACATCCTTTGGTCCGCCTTCAACCTC
ACCAACGCCGCTGTCCTCGCCCCCCTCTTCTTCTACAGCCCGGCCATCCT
TGCCCGCGCGGGCCTGTACACCGTTGGCATAATCGGTTCAATATCATTCG
TCGGCGCCACGGCCAAGGAGGACAAATACCTCTACCTCGGCGGCCCGCTC
CTCGCCGGTGTGGCTGTCGTGGCACTCTCCAGCCTTGCGCCCTTGGTCCT
GCCCCTCGGCTCCCGAGCCCTGATGGCGTCAGAGTCTATCTCCGTGTACG
GTGGGCTCGCTGTGTTTGGTGGGCTCACGCTGTACGACGTGCAGAAGATC
ATGAATAATGCGCGATTGGCGGAGCAGGGCCTCATCAAGAGGGATACGGT
CAATGAGAGTATTAGCCTTGAGTTGGACTTTATCAATATTTTCATTAGGC
TCGTGCAAATCCTTGCGAGCGGTCGGCAGAATCAGCGGTAGACGCAAAAT
GAGGCCAAGGGTGGTTGCATTTTGGGCATATCTCTTTGGAGGGTCGAGCT
ATGTCGATTCCTATCATTTTAGT

Sequences in the Contig:

SY0AAA2YE22FM1 SY0AAA39YN01FM1 SY0AAA4YP10FM1
SY0AAB22YO01FM1 SY0AAB23YM10FM1 SY0AAB32YL08FM1
SY0AAB37YD04FM1 SY0AAB40YB22FM1 SY0AAB60YK15FM1
SY0AAC16YJ18FM1 SY0AAC26YL11FM1 SY0AAC27YK04FM1
SY0AAC34YB05FM1 SY0AAC43YP15FM1 SY0AAC46YO15FM1
SY0AAC50YB19FM1 SY0AAC50YM07FM1 SY0AAD16YA09FM1
SY0AAD25YN19FM1 SY0AAD26YH06FM1 SY0AAD28YJ15FM1
SY0AAD2YE06FM1 SY0AAD34YD20FM1 SY0AAD35YM22FM1
SY0AAD4YG12FM1 SY0AAD53YI20FM1 SY0AAD57YJ16FM1
SY0AAD59YB07FM1