Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3785
Length(NT) : 1416
Best Gene Model Blast : Link to GSTUMT00001472001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SNOG_08391
Accession: ref|XP_001798705.1| Score: 1531 E_value: 1e-168
KEGG Definition: hypothetical protein
Accession: ncr:NCU06284.1 Score: 1511 E_value: 1e-166
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1107 Score: 1033 E_value: 1e-113
PFAM Definition: Vps35, Vacuolar protein sorting-associated protein 35. Vacuolar protein sorting-associated protein (Vps) 35 is one of around 50 proteins involved in protein trafficking. In particular, Vps35 assembles into a retromer complex with at least four other proteins Vps5, Vps17, Vps26 and Vps29. Vps35 contains a central region of weaker sequence similarity, thought to indicate the presence of at least three domains..
Pfam Number: pfam03635 Score: 1331 E_value: 1e-147
Swissprot: Q9EQH3|VPS35_MOUSE

Sequence:
>Contig3785
TTGGGGATAAAGGTGGGGATGTGGACAAGGACTCAAAAACGGTGGATGAG
TCCTCTGCGGAATCTACAGAGAAGCCCCCAAGAGGTATTCCGGAGGATGT
AAAGCTGTACGAGATTTTCTTCAAACAGGTGTTAAATCTGGTCAATGCCC
AAAATCTTCCAATTCAGGACATAATCGCCCTCTTGGTATCGCTAGCCAAT
CTGGCATTGAATATTTATCCAGACCGATTAGAATATGTCGACCAAATCCT
TTCGTATACCCACAAAAAGGTGTCAGAAATGGCCAACAGCGCAGATTTAC
ACTCACCACAGTGTCAACAATATATACTAAACCTCATGCTTGCCCCTGTC
AAATCATATGCATCCCTTTTCACAGTGCTTGCCTTGCCAAGCTACCTCCC
CCTTTTGCACACACAATCATACCCAACTCGCAGATCTGTAGCAGGAGTTG
TTGCGCAGAACATTTTGAAGAACCAAACCAAGATCTCCACCCCAGAGCAT
GCAGAAGGCATATTCGAGTTGCTGCGCGTATTGATTCGGGAAGGAGCACA
ACAACAAGCAGGATATCCTGGAGCACAAGCACCTAGGAAGAGTAGGGACA
TTGAGACAGACGAAACAGTTGAGGAGCAAGGTCGGCTGGCAAGGATAGTA
CACTTATTATGTAGTGACAATAATGATACCCAATTCAAGCTCCTGCAAAC
AGCTCGGAAAGCGTTCAAAGAGGGTGGCGATAGGATAAGATATACAACCC
CGGCTCTAATTACCTCCGGAATCAAACTTGCCCGGCGTTACAAGCTCCGC
GAGCATTATGACAATGAGTGGCAAACCATGAGCGCAGCTCTTTATAAATT
CTTGCACCAGACTGTCACCTCGATATATCGGGTTGGTGTGCCGGATTTGT
GTCTTCGGCTTTTCCTTTTCTGCGGTCAAGTATCAGATCAGACGGAATTC
GAAGAAGTCGCATATGAGTTTTTTGCACAAGCTTTTACCGTATACGAAGA
AGCAATCTCGGACTCTCGGGCCCAGTTCCAGGCTGTGTGTGTCATCGCTA
ATGCGTTGCACTCGACCCGAAACTTTTCAAAAGAAAATTACGATACCCTG
ATCACTAAATGTGCGCAATATGGTAGCAAGCTTCTCAAGAAGCCGGACCA
GTGTCGTGCGGTGTACCTGGCATCACATCTTTGGTGGGCTGTCGAAATAC
CAGCCAGAAGTGAGGATGAAAGGTCACCGTTGTACAGGGATGGAAAGAGG
GTTCTTGAATGCCTTCAGCGCGCACTAAGGGTAGCGGATGCATGCATGGA
CACCGCAGTCAGCGTGGAGCTTTTCGTGGAGATTCTGAATAGATACGTAT
ACTATTTTGATCGCCAAAACGAGGCTGTTACGGTCAAGTACCTCAACGGG
CTTATAGAACTGATTC

Sequences in the Contig:

SY0AAB10YA08FM1 SY0AAB32YD10FM1 SY0AAC16YJ10FM1
SY0AAC56YE13FM1 SY0AAD23YD03FM1