Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3784
Length(NT) : 657
Best Gene Model Blast : Link to GSTUMT00003334001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001213925.1| Score: 161 E_value: 1e-09
KEGG Definition: hypothetical protein
Accession: ang:An07g06910 Score: 147 E_value: 2e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3784
TTGGCTACTACTCAAACAATCGACAAACTCAATACTGACACCAAATAGCC
AGACCCACCTGCTTCCTTATCCAAGAAATAATACCAGCCATGCAAGCGGA
CACTTATCCAACCCCTCCCGCCTCACAGGCACTATCACCGAGCGAGCCAC
AAGACTCCGGCTCAATCTTTCTCCTCGAGTTGGGGGATGTGGAGTACCAA
AAGTATGATGGCATTGAATTGTTTGCTCGGACAGTTGATTCGCAAGCCGA
AAGGTCCCACTTGGGTTACGCAAGCGAGTATGTCGTGTTTACGCAGGTGG
CGGATGACGAGCTCGCAGAAATCGACAATTTTCGTGATACCTACCGGAAA
GCTCTTCGTTTCCTGTATCTGAACCACGAAAATACTTTGATTGTTAAGGT
TATGCCTGGAATGATACACGAGAGTTTTGGCCGTGGCCTTATGAACGCAG
TTTGGAAACAGACAATAATGATGGGGGTAGATGAGGAACTAATAACTGTT
GGCAGTACCAGGTTTCACGGCACAGGGAGCCAAAAGGAAGCCGACGAGGC
TGTTAAGCCATTCACCTCTCGTCCTCTTAAAACTGACTGGCCAACTATTG
TCATAGAGTGTGGGATATCCCAATCGCAAAACCACTTGCGCATGGTAGCA
CATTGGT

Sequences in the Contig:

SY0AAA55YM16FM1 SY0AAC16YJ02FM1 SY0AAC37YH01FM1
SY0AAC5YH23FM1