Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3783
Length(NT) : 824
Best Gene Model Blast : Link to GSTUMT00000566001 E-value : 1e-159
Numbers of ESTs : 4

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001543047.1| Score: 173 E_value: 8e-11
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_3G10230 Score: 151 E_value: 1e-08
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG1830 Score: 125 E_value: 8e-08
PFAM Definition: Seipin, Putative adipose-regulatory protein (Seipin). Seipin is a protein of approximately 400 residues, in humans, which is the product of a gene homologous to the murine guanine nucleotide-binding protein (G protein) gamma-3 linked gene. This gene is implicated in the regulation of body fat distribution and insulin resistance and particularly in the auto-immune disease Berardinelli-Seip congenital lipodystrophy type 2. Seipin has no similarity with other known proteins or consensus motifs that might predict its function, but it is predicted to contain two transmembrane domains at residues 28-49 and 237-258, in human, and a third transmembrane domain might be present at residues 155-173. Seipin may also be implicated in Silver spastic paraplegia syndrome and distal hereditary motor neuropathy type V..
Pfam Number: pfam06775 Score: 265 E_value: 4e-24

Sequence:
>Contig3783
TTGGCGCCGCCACCAGTATCTACACTCTCTCTTAATACCGAATACTCGGC
TACAACGCTGACACCCTAAACAGTAATCCCCTAATAGCTAATTAATGAAA
TGGTTCTTCGCCCAGTACTCGTACCTCCCCTCCAACCAAACTTTATCAAA
AAGCTAATAGGAGCTCACAACAGTCTAACAGCTTCCTCCTCCTCCTCCTC
CCCCTCCGCTTCCTCCGCTTCCTCCGCTCGCGGCCCGCACAACGCGCCTA
CCTAACCACTCTTCTCCTAAGCATCTCAACCCTGATCCTCTTTTTCCTAG
CCGTAATCTCCTACACCCTTTTCTACATCCACCACATTCCACACATTGGT
GTTCAAAAACCCCTGCACCTACAATTCCCCATCTCCCCATCCACCCCACC
CCACTCCTCCACCCACCAACACCATCACCATCCAACCGGCGCAATCCAGT
TCAGCGGTGAAATCATCCCACGACAGGAATACTCCGTCGCCCTCCTCTTA
CACCTCCCGCCCTCCCCCGAGAACCAGAATGCTGGGAACTTTATGGCTGA
AATAACGATTTACTCTACTCCTCTCTCCCCCTCCTCTTCAGCTTCCATGC
CGGGAATGGTGATAGCGACCGGTCGTCGGGGAGGGTTAATGCCCTGGCGC
AGCCCCATCGCTCGCACAGCGCACACGTTACTTCGACTTCCGTTACTGCT
CTTTCTACCAAATGCGAAGGAGGAGGAAGCCATCCGTGTGGTACTGCTTG
AGAACGTAGTCTTCGGTGAGCTCGCCCGACATGCAGTGGTCAGTCTAGAG
AGCCGCTCGAGACTGGACGTGTAC

Sequences in the Contig:

SY0AAB59YO09FM1 SY0AAC16YJ01FM1 SY0AAC36YO07FM1
SY0AAD29YN01FM1