Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3782
Length(NT) : 636
Best Gene Model Blast : Link to GSTUMT00008021001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_11504
Accession: ref|XP_001587512.1| Score: 288 E_value: 2e-24
KEGG Definition: hypothetical protein
Accession: ang:An15g07150 Score: 262 E_value: 1e-21
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG0969 Score: 155 E_value: 1e-11
PFAM Definition: No Hit Found
Swissprot: P30316|DPOD_SCHPO
Gene Ontology:
GO:0043625 = Cellular component: delta DNA polymerase complex
GO:0008408 = Molecular function: 3'-5' exonuclease activity
GO:0003887 = Molecular function: DNA-directed DNA polymerase activity
GO:0005515 = Molecular function: protein binding
GO:0006271 = Biological process: DNA strand elongation during DNA replication
GO:0000731 = Biological process: DNA synthesis during DNA repair

Sequence:
>Contig3782
TTGGGTGGAAACGCGACACCTCGGCGGCCGAAAGAAAAACCCACCTCTCT
CACACTCAGCACTCCTTGACACTCTAACCAGGTCCTTCCTTTCTCTTTCT
CTTTTCCTTTTCCTTTTCCTCTTTTCCGATACGGCGCTGACCATTGCCTA
AAATATTCTCGACCGACAGCAATCTTGTTGCCACCCAACTTGTCTCCACA
CAATCAAGATGCCATCCGCCGGCAAGAAGAGAAGAATAATTGCTTTCGAC
AAAAACGGAAAACGCCAGAAAGAGGAGCCAACGGAGTCAGACGAAGACCG
TGTTCCTCACAAGAAAGCTAAGAGTGATACTCTAGAGCAGCGCCGTGCCC
AGTCGTTAAAGCACACGAAGAGCAGCTTCGAAGAGGATTTGGGGAGGCTT
ACCCAAGAAGTCAACGAACTTAAAACAGGAGGCCAAGAGCAAGACCAGGA
TTGGTGCCGACCTCACCTACCGAAAAGTTGGAATCCTCAAGAGGAAAGTT
TGATTTTTCAGCAGATTGAGTGCGATGAGGGAACATTCGATAGGAAAACC
ACAATTCAGCTGTTCGGTGTGACGGAGGCTGGCCATTCAGTTCTCCTTCA
TGTCACAGATTTCCACCACTACCTTTACGTCGCAGC

Sequences in the Contig:

SY0AAC16YI06FM1 SY0AAD29YK02FM1