Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3781
Length(NT) : 1566
Best Gene Model Blast : Link to GSTUMT00004268001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: proteasome regulatory particle subunit Rpt2
Accession: ref|XP_753929.1| Score: 1759 E_value: 0.0
KEGG Definition: proteasome regulatory particle subunit Rpt2, putative; K03062 26S proteasome regulatory subunit T2
Accession: afm:AFUA_5G07050 Score: 1759 E_value: 0.0
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0726 Score: 1998 E_value: 0.0
PFAM Definition: AAA, ATPase family associated with various cellular activities (AAA). AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes..
Pfam Number: pfam00004 Score: 532 E_value: 9e-55
Swissprot: P40327|PRS4_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0008540 = Cellular component: proteasome regulatory particle, base subcomplex
GO:0016887 = Molecular function: ATPase activity
GO:0004175 = Molecular function: endopeptidase activity
GO:0005515 = Molecular function: protein binding
GO:0006511 = Biological process: ubiquitin-dependent protein catabolic process

Sequence:
>Contig3781
TTGGTCCACCCACCATCGTCATCCAAGTCGCCTTTATCCTTTTCTATTCA
TAATACTCATCTGTCGTCCAGTGTCTTCTATTTCATCAACCCTTGAACGA
TAAACTAAGCAGAGTCACCATAAAGATTTGATATGGGTAATACTCAGTCT
GGAATAGGCGGACCTCCAGCGGGAGATGGCGAGAAGGGCAAAGATCAAAA
GAAGGAAAAGCCAAAGTACGAACCCCCCCCACCGACTACTCGTGTCGGCA
GGCGCAAGCGCCGTACCGCTGCCGGACCAGACGCTGCCAGCAAGCTTCCA
ACGGTTTACCCCAATGCTCGTTGTAAACTCAAACTTCTCCGGATGGAGCG
TATCAAGGATCATTTACTTCTTGAGGAGGAATTTGTTCAGAATCAGGAAC
GTCTACGAGGGAGCAAGGGTGAGAAGGGAGGGTTGGAGCAGAGGCAAGAG
GAGGAGCGGAGTCGTGTTGACGATATGCGTGGGAGCCCAATGGGAGTTGG
GAACCTGGAGGAGATGATTGATGATGACCATGCTATTGTCTCTAGTGCTA
CAGGCCCTGAGTACTACGTTTCCATCATGTCATTTGTCGATAAGGATCTC
CTGGAGCCTGGGTGTTCCGTTTTGCTGCACCACAAATCGGTCTCGATTGT
TGGTGTTCTTACAGAGGATTCAGATCCTTTGATCTCAGTTATGAAGCTTG
ATAAAGCTCCTACAGAGTCTTACGCGGATATTGGTGGTCTGGAACAACAG
ATTCAGGAAGTTCGTGAGGCGGTTGAGTTGCCCTTACTTCATCCTGAGCT
TTATGAAGAGATGGGTATCAAGCCTCCCAAGGGCGTCATTCTTTACGGCT
CTCCCGGCACCGGTAAAACCTTGCTTGCGAAAGCGGTTGCCAATCAAACA
TCCGCTACATTCCTCCGTATCGTTGGTTCTGAGCTCATTCAGAAATACCT
TGGGGATGGCCCTCGTCTTTGTCGTCAAATATTCCAGGTCGCTGCTGAAC
ACGCACCTAGTATTGTCTTCATTGACGAGATTGATGCTATTGGTACCAAG
CGTTACGACTCAACAAGTGGTGGTGAAAGGGAAGTCCAGAGAACCATGTT
AGAATTGCTAAATCAACTGGATGGTTTTGATGATAGAGGTGACGTCAAGG
TCATTATGGCTACCAACAAGATTGAGACTTTGGATCCCGCCTTGATTCGT
CCGGGTAGGATTGATCGTAAAATCTTGTTTGAAAATCCTGATCAAAATAC
AAAACGCAAGATTTTTACCCTCCACACCTCAAAGATGTCGTTGAGCTCTG
ATGTAGAACTTGAGGAGTTTATCAATCAGAAGGACGATCTTTCTGGTGCC
GATATCAAGGCTATCTGTACTGAGGCTGGATTGCTCGCTCTGAGAGAGCG
GAGGATGAGGGTACAAATGGCGGATTTTAGGACGGCTCGGGAGAGGGTCT
TGAAAACCAAGAGCGAGGGTGAGCCTGAGGGACTGTATCTGTAGCTGGTT
GGCTTGTTGTTGCTTTGCGCGTAAATAATTGAGGTTTTACAATGGACTCA
GTTGGCTCTTCAAAAA

Sequences in the Contig:

SY0AAA40YB11FM1 SY0AAA50YK15FM1 SY0AAA57YI05FM1
SY0AAA58YB14FM1 SY0AAA9YG12FM1 SY0AAB27YF16FM1
SY0AAB28YC09FM1 SY0AAB44YK17FM1 SY0AAB48YD24FM1
SY0AAB49YD24FM1 SY0AAB59YK21FM1 SY0AAC16YG23FM1
SY0AAC16YL08FM1 SY0AAC8YF01FM1 SY0AAD12YK17FM1
SY0AAD17YG13FM1 SY0AAD31YD06FM1 SY0AAD6YA04FM1