Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig378
Length(NT) : 1425
Best Gene Model Blast : Link to GSTUMT00010137001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein BC1G_01996
Accession: ref|XP_001559332.1| Score: 1117 E_value: 1e-120
KEGG Definition: hypothetical protein [EC:3.1.3.16]; K01090 protein phosphatase
Accession: mgr:MGG_05207 Score: 1112 E_value: 1e-119
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0698 Score: 403 E_value: 8e-40
PFAM Definition: PP2C, Protein phosphatase 2C. Protein phosphatase 2C is a Mn++ or Mg++ dependent protein serine/threonine phosphatase..
Pfam Number: pfam00481 Score: 441 E_value: 3e-44
Swissprot: P40371|PP2C1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0000173 = Biological process: inactivation of MAPK activity during osmolarity sensing
GO:0006470 = Biological process: protein amino acid dephosphorylation
GO:0009408 = Biological process: response to heat

Sequence:
>Contig378
TTGGACCAAGGTAAATCCACATCCTCACGCTGTGAGTAGATTAGAGGTGG
GGATATAAGCTTAAGCTTAATCCAGCCCGAGCAACCGAACAGGCACAAAC
TCTACGAAGCGCTCAATAACCATTACTCCGAAACCCTCAACTCCCGCCCT
CGGATAGTCGGATAGCTCGGTTCCCGGATAGGACCAATATACTGCGGCCA
CCAAAACCGTCTTTAGGAAAAGCTGGCTGGAAAGAGACGTACGTTGACCA
GCTCCGGCGGTGGTTTATTCGCCAGGATGTTCGGAAATAATAATCCACTC
CCAGCCAATACTGCGGAGGCATCGCCTCCCGCAAAACCCACTAGCCCCCC
CGCTCCTCCGCCCCTTAATACGGCTGCAGTGGTAACCCCGCCGCCCCCGG
AGAAAAAGAGGAGGGGATCCGTCTCCAAGGCTTCGGCGTTCATCGCATCT
GCGAGGAACTCGCTCTCTGGTTTGGGGAGCAGCAATGAAGAGAAGGAATA
CGAGAAAGCCATAAAACAGGACCCGAGCACAGTTCCTGTTGGTCCTCATA
ACAACTCGGCCGGAGACTCGAGACCGGGGCCAAAGAGTACATTTAGAGTT
GGGGTGACGGAGGACAAGAATAAGAAGTGCAGGAGAACCATGGAGGATAC
GCATTCGTACCTATACAACTTCTTGCAGACCTCGACGTCCAACCCTCCGG
GAACCTCTTCCTCGACCGCTACATCTGCTTCTGGTGCCGACTCCTCCCTA
TCGAATGAAGAGCCAGTTGACGACTCAGACAATGGTTACTTTGCGATCTT
TGATGGACACGCAGGAACATATGCGGCTGATTGGTGTGGGAAGAAGTTAC
ATTTGGTGCTTGAGGAAACGATTCGGAAAAATCCCAATACACCCATACCA
GAGCTCCTTGATATCACGTTCACCAATTGTGACGGCCAGCTGGAAAAACT
GCCTGTTAAGAATAGCGGTTGTACAGCTGTTTGTGCGGTCTTGAGATGGG
AGGAAAGGAGATTGCCCGGCGCTCTTGCCGATGCGCCAAAGGAGAATGGG
AGTGGTAATAATGAGAATGCTAAGCCCGCTACAACCCAACAAACCGAGAG
GCAGAGAGTGTTGTATACTGCAAACGTAGGAGATGCCAGAATTGTTCTTT
GTAGAAGCGGCAAAGCCTTGAGATTGAGCTATGATCATAAGGGGAGTGAT
GAGAATGAAGGGAAACGTGTTGCCAACGCCGGGGGGCTCATATTGAACAA
TCGTGTCAATGGAGTTCTAGCCGTAACCCGTGCTTTGGGCGATAGCTACA
TGAAGGAGCTAGTCACTGGACACCCTTATACCACCGAGACAGTTCTTCAA
CCCGAGGCAGATGAGTTTATCATTCTCGCTTGTGATGGGCTTTGGGATGT
CTGTTCAGACCAGGAAGCCGTTGAC

Sequences in the Contig:

SY0AAA22YF19FM1 SY0AAA24YF17FM1 SY0AAA24YF17FM2
SY0AAA34YC02FM1 SY0AAD13YK21FM1