Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3779
Length(NT) : 1654
Best Gene Model Blast : Link to GSTUMT00006811001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57320.1| Score: 1096 E_value: 1e-117
KEGG Definition: predicted protein
Accession: aor:AO090003000089 Score: 1096 E_value: 1e-118
KOG Definition: No Hit Found
PFAM Definition: Ppx-GppA, Ppx/GppA phosphatase family. This family consists of the N-terminal region of exopolyphosphatase (Ppx) EC:3.6.1.11 and guanosine pentaphosphate phospho-hydrolase (GppA) EC:3.6.1.40..
Pfam Number: pfam02541 Score: 371 E_value: 5e-36
Swissprot: P32608|RTG2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0046695 = Cellular component: SLIK (SAGA-like) complex
GO:0005515 = Molecular function: protein binding
GO:0030528 = Molecular function: transcription regulator activity
GO:0001310 = Biological process: extrachromosomal rDNA circle accumulation during replicative cell aging
GO:0031930 = Biological process: mitochondrial signaling pathway

Sequence:
>Contig3779
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCTTCCTTGGAAGTTATT
GAAGTTGAAGGTGAAGCAACAACTGGATAAGAACTACGGTACTCGAGTAG
CTTCAGAGCTCCTTCGTGGCAACCCCTTCCCCCACGGACAAACCTTTCGT
AGAAGAAAACAGCCGGACGAATTCACAGACGAGAAATCATGGCAGAAGAA
AGAGTGCAGCAGAATCCGCTGCTTCATGGGCTAGTTGATATTGGGAGCAA
CGGCGTCCGTTTCTCCATCTCAAGCCTTGACCCCGCAACGGCCCGTATAA
TGCCCACCGTCTTCCAGGATCGTGCTGCGATCTCGCTGTACGATGCGCAG
TTCAGCGGGACGACAAAGTCCCCCATCTCCAAAGAGGTCATCGGGCAGAT
CCTGGCCTCCATGCGACGTTTCAAGTCCGTCTGCAGCGACTTCGGTGTGC
CGGATCAGAACGTTCGCGTAGTTGCCACCGAGGCCACGAGGGAGGCCCAG
AACTCTGCCGAGTTTCGTGACAGAATCACCGAAGTCTCGGGTTGGGATGT
GGAGCTTCTTTCCAAGAGTGAGGAAGCGAGAATCGGGGCTGAGGGCGTTG
CAAGCTCTGTCGGGTGCGTGACGGGCCTCGTCATGGACCTCGGTGGTGGG
AGTACGCAGCTTGGTTGGATGAGGAGCGAGAAGGGGGTTTGCGAGATGGC
GGAGAAACCGGTCAGTATGCCATATGGAGCCGCAGCACTGACGAAGAGGA
TCGAAACGGCGATAGATAAGAGGGCTATAGGGCTGTTAAGGGATGAAATG
AAGGAGAGGATTGCGGAAGCCTTTACCTCGCTGCAAATACCGGAGGATTT
GCAGCTTGACGCCGAGGCCGAGGGTGGATTTACCATGTATTTGTCCGGTG
GAGGATTCAGAGGGTTCGGATACCTGCTGTTGGATCAGCATGATATCAAA
CCATATCCCGTGCCTATCATCAATGGGTTCAAGGCACCTGGGAATGCGTT
CTCAAGCCTGGCAGATCTGCACTTGGATCCCGAGCTGAGCGATCGTTTGG
GCGAAAAGTTCCGGATATCTGGCCGGAGAGCAAGACAAATCCCCGCCGTG
GCATTCCTGATAAACACACTGATAGAAACCCTCCCAAAAATCAAAACCGT
GATTTTCTGTCAAGGTGGCGTCCGAGAAGGCGCCCTCTTTGAAAAGCTCC
CTCGTGAGATCCGAGCCCAGGACCCACTCCATGTAGCAACACTCCCTTTC
GCTCCTAGATCCACCGTGCCCGTCAGTCTCCTCCTCAGTTACGCCCTCCC
CCGCTCAGCCCCCTACATCATCCGTTTCGAGACGGCGCCCGCCCTCTCAA
ACATGCTAATCTACCACTCTAACGTGCCTAAAGAATCTCGCGCCTCCTGC
GGCCTGCACAGCACCACAACTGGAATCCTCGCCAGCGCCCACGGTCTGAC
TCATGAGACCCGCGCCCTCCTGGCACTCTCCCTGTGCGAACGCTGGGGCG
GGGAAGTATCCGATTCGAACCTCAAGACTCGCCTGCAAGACCTCGTCGGT
CCGGAGTTGGCTTACTGGGCGCGCTACCTGGGTGCTATAGCTCGCGTCGT
GGGAAACGTGTACCCGGCTGGAATCATCGGAGAGGAGAAACTCCGCTTCT
TTGC

Sequences in the Contig:

SY0AAA33YD10FM1 SY0AAA57YP07FM1 SY0AAC16YF23FM1
SY0AAC1YF12FM1 SY0AAC33YJ13FM1 SY0AAC3YO03FM1
SY0AAC62YB17FM1 SY0AAD1YN13FM1