Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3778
Length(NT) : 1109
Best Gene Model Blast : Link to GSTUMT00003655001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: C6 zinc finger domain protein
Accession: ref|XP_001269926.1| Score: 183 E_value: 8e-12
KEGG Definition: hypothetical protein
Accession: ang:An08g10880 Score: 176 E_value: 3e-11
KOG Definition: No Hit Found
PFAM Definition: Zn_clus, Fungal Zn(2)-Cys(6) binuclear cluster domain..
Pfam Number: pfam00172 Score: 150 E_value: 1e-10
Swissprot: Q9C0Z1|YKM1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig3778
TTGGGCTCGTACAGTACTGTCCAAAGTAGGGGGAAATGAATTCGGACCAC
TGGACTCGGCCTGCTCGTTTCTGTTTAGGAGACGGATATAATAGATGCGC
TGGGTATATATTGTGTTAAAGAACTGTGTGCTTTCCAACCTTCAACCGGT
TCAGTACCCCCAGCTGCAGATCGGTATTGATTCATCCATTCATGTACTGG
ACTAATCAGACCTTTTACCTTTGTTGAGCACATTAATCGTTTCGACCGTA
GTGGATGGACGGACCAAACTGGATTATTGTACCTTTCGCTTCCTAACCCT
CGCTTGCTTGCTTTCTTAACTCTTATTTTCATAATTTCAACCTTTAACAC
TTCAAACATCTGTACGGGCCACTGATCCTAATCGGTTATTAATCACCAAC
CAGTAAACGTCTGACCTGCCATACGAAGCCTTCCTCGCAACCCGCTGAGT
TCTCGCCTCACGAACAGGATGAGTCTCAGCCCGCAAGCCCGCAACCCGAG
TAATCAGCATCAGGACGACTCTTCGGGTCAGGGAGAGCGACACTCGGCGA
GAAATCCTGCGTGCGACCTTTGTCGTGAAAAGAAGGTACGATGCGGCCGC
GAAAAACCCACCTGCCAGAACTGCCGATCGTGGAGAACAGCTTGCACGTA
TTCCGAGCGACAGAAACGCGATAATGAGGCTTCCCGCACTGCGCACCGCT
TCGAAGAGGTGCACGACCGCCTTGACCGTATAGAAACCACAATGGCGCGA
CTAGTCGCCGCACTCGAGTCCACAAACTTGGCCTCTACCCCTCCGCCAGC
GTTCAATTCAAAGACTATTGTCTCGAGCAGCCGCACTCAATCACAATGCG
GTCCCGGAACACCACAGACGCCACAGTCAAATAGCGGTAGTCTACTGGCT
ACGACGTACAAGATACCCGTACGGCGAGAGATGCAGTACCTCGGCCCTTC
ATCCCTCATGACACTATCCTCGGAAGCGGGGTCCCTAGCGGAGGAGCAGT
TGCGGCTTAGTTCGCCGCCGCATCCGAGCAGCGAGGCAGGTAGCGGCGTG
TGCCATCGACGGGGGACAAGCGACTCTACGAGGGTGAGTGTGGATGGGGA
TATTGGGGC

Sequences in the Contig:

SY0AAA54YO05FM1 SY0AAA58YD10FM1 SY0AAC16YF21FM1