Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3777
Length(NT) : 565
Best Gene Model Blast : Link to GSTUMT00001644001 E-value : 2e-21
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3777
TTGGGCGTGATGAGGTGTGTGTGGATTAGGCTGCTGCGGCTTTTCTTTCT
TCTTCGTGGAGTGATTACTTGCTTCCTCCGTGAGTTGTCCCCTCCTTCCC
TGGTCGATGATTTGGCGAGGATTATTATGTGCACTGGTGGGGGCGCTCGG
ATAGTGCTGATGGGATAAACAGAGTTTAAGGCGACTGGATATGGATGCGG
CTGTCAAGGTGGAGGATTGATAGACGAATCGCTTTCGGTATTTGTGGAGC
GGAAAATTGGTCTTGCGCTAGTTTAGGCGGACGTGGATGTGTAACGCTCT
GGTCGATGCCCTTATTGGAAAGCCCGCTATAATTAGATGGATAGGTACTG
CTATGGAATTATCATTTGAAAAAAAAAAAAAACTCGAGAGCCGCTTTATA
GCTCTTCGATGCATTACCGGTAGATTTGGCTGCCAATAGTCGTTTGCCTT
CGTATGTTTACGGTGCTTTTGCTTTGGACTTTGCCGGCCTGGCACCCGGA
GAATGCGGTTTCCCCCGGAATATAATAATGCGGTCATTAGGGGTTCCAAT
GATTTGATCCGCTTG

Sequences in the Contig:

SY0AAB11YJ18FM1 SY0AAC16YF17FM1