Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3776
Length(NT) : 691
Best Gene Model Blast : Link to GSTUMT00003937001 E-value : 0.0
Numbers of ESTs : 22

Blast Results:

Nr Definition: 40S ribosomal protein S23
Accession: ref|XP_001243230.1| Score: 720 E_value: 2e-74
KEGG Definition: AAR108Cp; K02973 small subunit ribosomal protein S23e
Accession: ago:AGOS_AAR108C Score: 706 E_value: 4e-73
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1749 Score: 706 E_value: 2e-75
PFAM Definition: Ribosomal_S12, Ribosomal protein S12..
Pfam Number: pfam00164 Score: 369 E_value: 3e-36
Swissprot: P32827|RS23_YEAST
Gene Ontology:
GO:0022627 = Cellular component: cytosolic small ribosomal subunit
GO:0005515 = Molecular function: protein binding
GO:0003735 = Molecular function: structural constituent of ribosome
GO:0006450 = Biological process: regulation of translational fidelity
GO:0000723 = Biological process: telomere maintenance

Sequence:
>Contig3776
TTGGGCAGCCTACGACAACCGCCACCATTACCTTTTCAGCCGTCAACACA
ATCGACAAAGTTCAAGATGGGAAAAGGAAAACCAAGAGGACTCAACGCCG
CTCGCAAGCTTCGAACCCACCGACGTGATAACCGCTGGGCTGATCAGTCA
TTCAAGAAGAGGCTCCTCGGAACCGCCTTCAAGTCTTCTCCCTTTGGTGG
TTCTTCTCATGCGAAGGGAATCGTCCTCGAAAAAGTTGGTGTCGAGGCCA
AACAGCCAAACTCCGCTATCCGAAAGTGTGTGAGGGTTCAGCTTATCAAG
AACAGCAAGAAAGTGACTGCCTTCGTTCCTAACGATGGTTGCTTGAACTT
TGTTGATGAGAACGACGAGGTTCTTCTCGCTGGATTCGGTCGTAAGGGCA
AGGCCAAGGGGGATATTCCTGGTGTCCGATTTAAGGTCGTCAAAGTCTCT
GGTGTTGGTCTATCTGCCCTGTGGAAAGAGAAGAAGGAGAAGCCTCGCAG
TTAAACAGGTTCGGGGGGGGTTCGGGTTTACTTCTTTCCTTCTTTAGCAT
TATGGATAGCAAAAAACTTGAGATGATATGGGGGTACGATACTTTGATTC
ATTTGGCGGACAACCTACGATCTAATGTAGTCATGGTGTAAAAAATCCCA
ACATAACGCGATGATAAGAAACCGAGGTCCACCTTGGGTTG

Sequences in the Contig:

SY0AAA24YG18FM1 SY0AAA24YG18FM2 SY0AAA25YJ06FM1
SY0AAA49YK24FM1 SY0AAA60YL22FM1 SY0AAB10YO13FM1
SY0AAB11YP07FM1 SY0AAB2YH03FM1 SY0AAB35YO02FM1
SY0AAB49YK02FM1 SY0AAB52YG08FM1 SY0AAB52YH04FM1
SY0AAB52YM09FM1 SY0AAB57YG15FM1 SY0AAB60YL11FM1
SY0AAC13YB07FM1 SY0AAC16YF02FM1 SY0AAC31YB17FM1
SY0AAC34YA14FM1 SY0AAC42YP05FM1 SY0AAD17YO18FM1
SY0AAD20YL03FM1