Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3775
Length(NT) : 667
Best Gene Model Blast : Link to GSTUMT00000580001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein HCAG_01795
Accession: ref|XP_001544748.1| Score: 324 E_value: 2e-28
KEGG Definition: calcium channel subunit Cch1
Accession: afm:AFUA_1G11110 Score: 300 E_value: 5e-26
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3775
TTGGGGGGACGCTAACCGGCATCTTTGCCATGAGAGTTTATGAAGAACCG
TTCACAGTGCCTGATATATTGGATGATTGTAGAGTGGATCCTCAAAGCCA
TAGTAGCGGCACAACTCGCGGGATCATAGAGGGTGTTGACTTGGAAGCAT
TGAATAGACGCGTTGCGATGATCCCCATTCATAAGATCCGGAGACAACGC
CATATCTATACTCTATTCTACGAAGAGTGTCTAGTGTCGGCTGATAAAGA
ATATGGGGTGTCCTTCACATCTGTTTTGCTTATACTCGCGCACTATAAAA
TTATTAATGACAATAGGAGCTTGAGATTGGAGGAATACCTTCGTCGCCGC
TATCGATTGCAAAGAGTAGAAGAGCAGGTGCAGCGGAATATTGTTACAAA
TTTCTTCTTATCTCTATACTGGAATAAGAGGTTCAAGGATCGACATAGGG
CCCACTCCGGTGCGCCGCAGGTTCCTCAGATATTTGTCGACGACGTGAGT
TCCAGTAGGCCAAACACCGGCCCAAACGTGCCACAGATACTGGTGGACGG
TGGAGAGGCGTCATTAAGCACCAGTTCCACATCAGCACAGCTTCACGAGG
GACCAGTGACCCCAAAAAGGCAAGCGCCACCTCCGTTGGACTTGGACTAC
CATGTGGGCAATAGCCG

Sequences in the Contig:

SY0AAC16YE22FM1 SY0AAC16YJ09FM1