Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3774
Length(NT) : 482
Best Gene Model Blast : Link to GSTUMT00006123001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein CHGG_08264
Accession: ref|XP_001225920.1| Score: 160 E_value: 7e-10
KEGG Definition: hypothetical protein
Accession: fgr:FG00836.1 Score: 148 E_value: 9e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3774
TTGGCTCACTAATTACCCAAGTGCAATCATCAAAATCCATCTCCATCCCC
CCCCCCGGCAGCAGAAGGGATGAATCGGGGCCTCTGCTCTTTCCTGCGTC
AGCCACCTCCTGGCCGCCGCCTGCTGCCGAACTTCTGCTTCACCCCTTGG
TCTCGAACCAACGGGAATGTTTCAAATCGGTTGCATACGAATTGGAAGTT
GGGAAGGAGATACTCGAGTACTATCGGTTTGCAAAAGAGCGGATTTATAG
ACGTGGCGCCCGGGGAGGGTTTGTTGTTTTTTGATAATGTCTACCCCCTC
AAAACGGCAATCTACGACATCCGCTACCTAATGATGCGCTACGACAAGCA
ATCCATAGAATCGCGCATCCGGGCGCAATACATTCCGGAGGGCCTCCTCA
ACTCGGAATTCACTATAACGGAAATAGTGCCAAGATTGAAAGAGGGAGGT
GCATTCGTCAAGTTCCGCTCACGGAACGTGGA

Sequences in the Contig:

SY0AAC16YE15FM1 SY0AAC26YG13FM1