Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3773
Length(NT) : 656
Best Gene Model Blast : Link to GSTUMT00008863001 E-value : 0.0
Numbers of ESTs : 13

Blast Results:

Nr Definition: hypothetical protein BC1G_11034
Accession: ref|XP_001550626.1| Score: 773 E_value: 1e-80
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03690 Score: 681 E_value: 3e-70
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG2877 Score: 563 E_value: 8e-59
PFAM Definition: CDP-OH_P_transf, CDP-alcohol phosphatidyltransferase. All of these members have the ability to catalyse the displacement of CMP from a CDP-alcohol by a second alcohol with formation of a phosphodiester bond and concomitant breaking of a phosphoride anhydride bond..
Pfam Number: pfam01066 Score: 109 E_value: 4e-06
Swissprot: P17898|CPT1_YEAST
Gene Ontology:
GO:0004142 = Molecular function: diacylglycerol cholinephosphotransferase activity

Sequence:
>Contig3773
TTGGGTCCGTTTACACCACTGAAGATCCATACTTTCTTCTAGACCACTCC
TTTTGGGTTTTTATTTCTTTGACGGATCTGAAATCATGGCTAGCAACCGG
GTTGATAATCGGCCAAAGGGATCGAGAGGTCGGAGAAGGAGCTCTGAGTT
CCTTTCCGAAGATCAATTGGTCCATTTGAAGACGTACCGTTACCAGAGTG
TTGATAAGTCTTTGATCTCACGATATATTCTAAAGCATTACTGGAATTTT
ATGGTTGAGCTTCTGCCTCGGTGGTTGGCACCTAATGCTGTTACGCTCGT
TGGGTTTGGGTTTATCTTGACGAATGTAATATGCTTGGAAATTTGGCTGC
CGGATCTTGTGGGCCCTGGCCCTAGCTGGCTATATTATTCTTTCGCTTTC
GGTCTCTGGGCGTACTCGACCATGGATAATATCGACGGGAAGCAAGCTAG
AAGGACTGGTTCTAGTTCCCCTTTGGGAGAACTTTTTGATCATGGAATTG
ATTCTCTCAATTGCACTTTGGCCAGTTTGTGCGAAACAGCCTGCATGGGG
CTCGGTCCTACCAGGGCTGGTGTCTTTACTGCTTTGATTCCTACTCTACC
AATGTTCTTTTCTACCTGGGAGACATATCACTCTCATGTTTTATATCTCG
GATACT

Sequences in the Contig:

SY0AAA10YH15FM1 SY0AAA38YO16FM1 SY0AAA50YD12FM1
SY0AAA6YL20FM1 SY0AAC16YD15FM1 SY0AAC16YP05FM1
SY0AAC7YC09FM1 SY0AAD23YF20FM1 SY0AAD23YL24FM1
SY0AAD28YL20FM1 SY0AAD35YG11FM1 SY0AAD50YI23FM1
SY0AAD5YK03FM1