Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3772
Length(NT) : 1695
Best Gene Model Blast : Link to GSTUMT00009510001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3772
TTGGGGATATCCTCCCGTAACCGACTACACAGCCAATGATTATTACGGCC
AGAGTACAGCCCCATCGACGCCCAGCTCATCTCTTCCTCCATCGGATTAT
CGAGATGGATATAGATCATCAGAGTATAGTGTGATGCCCCCTCCCCCTCC
GATTGCGAATCGTCGGAGTAGCATGAGAGCGCAGGCAAATGCTGGTGCTT
CCATCGACTCGTCCCCTGATTATACTCACTCGACACCCCATCGCCCACAA
AGGCGAATGAGTAGCCGCGCTCACGGTAGCGAGAGATCCTCATCTTGGTA
TGGCCAAAGCCAACTGCAATACCAGGAAGCACCCGAACGGAGTTACTCCG
TTCCCCCAACAAACACTGGTGCCCCTGCTGAGAGTTCTCGACGCAGGGGC
ACTACCCCGCAGCCAATGCGCAGAAGAGAAAGCAACAACTCGCAAGGGAC
CTCGGGTTCTCATTCTGCTAGGCTGGGGCCTTCTGCGCTTTCGAGGTCGA
TGGAGGCCTGCACTATTGATGATCATACACCACGATCATCTCATCACCGC
CACAGCAGCAGCGGCCATCACTACGACTCTCACCACGCAGTAGCCCGCCG
TGAACCAGGGACTATGATGCAAAGCAGTCGCAGCAATGGAAGTAGTGACT
CTGGCAGTAGCAGTGGCCATGAGGGGAGAGAAGAGCTGGTGCAACTTACC
GTACCAGATTCCGACGAATCATTCACAATGAGGTATCCTGCGGGTATCCC
GGTGAAACTACAATTAAATGGTGGGACTTTCCAACGGATCCTTTCTTTTG
GCCGTAAGAGCAAGAATGTGAATATTGAGGATCCTATAGCATACGGATGT
GTTCGGCAGAGACAGCAGCAAGTGCATGCCCAGTTGCAGTATGCGGCCGG
CCAACTTGATCATAGCGATCGACGGACAAGTGCCGAATATCACCACCGGT
CCAACGGTTATCCTCGCAGGGAGATGGCCGGTGTTTGAGTTAATTACGAT
CTGTCTATGGCTAGATGGGAACTATTGTTGGCTGCCTTAACGGAAGATGG
CCTTGCTTTGTCTTTCAGTAACTGTAGCGTAAAGCACTGTTGCCGGACCT
CGACGAGCAAAGAAGCCCTGGCAACGATGACAGCAATGGACAATGATGAA
TGGTGATTTGGGCGAGGAGATTTCTTTATGCTTTTGTCTCATAGCTAGGG
ACGGGGTTTTAGTTCCTATGTTTATATGAGATGACTCTTATGCACCTTAG
TTTTTTTTTTTGTCTGTTCCGCTTCTTCGCCCTCAGGAGGTTATCGGGCA
TGTTGGTTTTGACTCATCTGTCAGTTGTGGCTACCACACTTTTATTCACA
AGCACGGCAAGGTACCTTTTCCTTTTCTGCCTTTTTGCTTTCGTGTTTAT
CATTCACCATACTACATTCTTATCATTTGGGCTTTGGTTCTTTTCTTTAC
GGTACCTTTTATTACTACAATATGTTGGCGGCAATATTTTGTTATTTGTT
ATTGTTTTCTTTGTGTTATTTTATTTGGTTGACTTGAACGCCTCGATATC
CAGCCTCGGCGTAAAAGCTCCTGGTTTTTGGATATGGAAGCGGGCTTCAA
AACTTCAGGCTTCAACTTTTCTTTCCTTTCCCCCTTTCCCCTAATCCTTT
TCCTTTTCCTATGTCTGTTAATTGGGGGTGTTTTTGGTTTTTTTT

Sequences in the Contig:

SY0AAA11YF24FM1 SY0AAB32YI11FM1 SY0AAB54YG03FM1
SY0AAB6YG01FM1 SY0AAC16YD14FM1 SY0AAC23YL16FM1