Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3771
Length(NT) : 692
Best Gene Model Blast : Link to GSTUMT00002163001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein BC1G_12912
Accession: ref|XP_001548517.1| Score: 457 E_value: 6e-44
KEGG Definition: hypothetical protein
Accession: mgr:MGG_03663 Score: 349 E_value: 1e-31
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: O74383|YNV8_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig3771
TTGGCATCACCGTAATCGTGCAGCAATACTCAATTCGCCGTCAACAAACA
CAACAAAACAATGCCTGGAGCAGCAGCCAACACCGGAAAGTCCGTCCTGA
AGCAGGGTGCGAAACGTGATCCCGAACTTTATATCCTCCTCGCCGTAATG
TCCGGTGCTTTTGGACTTGCGGGTTTTTACTTCGGACGGAAGCCTACCTC
GGCAACATCCGAAGAAGGCCGTATCAATGTTGCCAAGGATGGAATGCCAT
GGCATAATGAGTCGACCGAGACTTCTGCTAGGGATCACTTCAAGTATAAG
TACCATCCCGGTGGAGACGCCAGGAACCCGCCCAAGGATGCCCCAAGCGC
TTTGCACTCTGTTGTCATTCCCAGCGTCAACTTGCCAAAGGAACTTCACG
ATAAGTACAACAAGTGGGGCAAGGACGGATACTAAACCATTATATCACTC
CGGCATGAGCTGCTAGTCCTTGCTAGTGGCGTATTTTTTTTCTCTCTTGT
ATACCAAAATTGGTGCGTGGGATTGTATAGAGTAGTCGGGGGGGGCTTCT
TATTTCCTTGTTTTATTAGTTTCCTCTTGGTTCAATCGGACCGGGGATGG
GACCGATCAGTTGAAAATGCCGAGCAGGATTGGGGTGGCTGGCTTTAAAT
GCATCCCCTGTTTCCAGATAATCTGGCTTGTGTGGTATTTGT

Sequences in the Contig:

SY0AAB36YO13FM1 SY0AAB3YB07FM1 SY0AAB45YL02FM1
SY0AAC16YD12FM1 SY0AAD34YF19FM1 SY0AAD34YL04FM1
SY0AAD46YA04FM1 SY0AAD49YL16FM1