Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3770
Length(NT) : 1363
Best Gene Model Blast : Link to GSTUMT00006873001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_13283
Accession: ref|XP_001585767.1| Score: 319 E_value: 2e-33
KEGG Definition: hypothetical protein
Accession: ani:AN3924.2 Score: 285 E_value: 2e-27
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2498 Score: 143 E_value: 1e-09
PFAM Definition: RED_N, RED-like protein N-terminal region. This family contains sequences that are similar to the N-terminal region of Red protein. This and related proteins contain a RED repeat which consists of a number of RE and RD sequence elements. The region in question has several conserved NLS sequences and a putative trimeric coiled-coil region, suggesting that these proteins are expressed in the nucleus. The function of Red protein is unknown, but efficient sequestration to nuclear bodies suggests that its expression may be tightly regulated of that the protein self-aggregates extremely efficiently..
Pfam Number: pfam07808 Score: 140 E_value: 2e-09

Sequence:
>Contig3770
TTGGATCTTTGGACTATGTACTCGAGTACTCGTACTCGAACCATAACCAA
CCTTGAAGAACTCAGACACCCCTGCACTAGCACACAACAGCTCCAACACT
CGATTTCTGCTCTTCCTTTTCATCAAACTATTGACGGTTACCGAAGGAAT
GAATAACGCACAATTCCGCAAACTCCTCGAAACGCCTCGTCCCGCAAACG
CATCCAGCCAAAATGGGCCCTCCTCGACTCCGGCGCTGGGTTCTAAGTTG
CGGCCCTCAATCCCGATGACCCCGTATGCACCCTCTCCTCCCCTCTCACC
TTCTTCTACCGTTTAGGAGACAAACTGAGCGAATGAATGTACAAATCAAC
AGGCGAAGCGTCCTCGGTGGCTCATCAACACAGTCCGAGTTCGCACGTCA
ACTAGCGGCGAACAACGCCTCCGAGCAAAAGACAAAAAAGTTCCGCTCCT
CAGCTGCGCCCCTCGGCACACGACTACCCGAAGGCTACGTCGACCGGACG
AAAGACAGAGAGGACGACGGCGGCGACGAGAGGGACCGGCGGTTAGCAGC
GCTGGAAGAGCTCTACAAAGAGGGCGGGATAGAGCATGAGGAGTACGTTC
GGCAGACAAAATTGCTGGGCGGGGATGTGTCGAGTACGCATCTTGTCAAG
GGATTGGATTTCAGGCTTTTAGAGAAAGTGCGCAGAGGTGAGGACGTCAT
GCGTGTGATTAGGGATGATGAGGGCAATGGGGCGGAAGAGGGGCGGGATA
GTGAGGGTGAGGAGGATGTTCTGGATAAAGTTCTCGAGAAGGATGTTGTT
CCCGGGAAGAAAGAGGAGAAGAAAAAGAAGGGCAATTTGGCACCGAAGAC
TCGTGCGGAGATATTGGCGGAATTGAGGAGGAGCAGGGAGGCTGCGAAGC
CGGTTTCTATGCTTGGTTCGAAGTTCAAGAAGATTGGCGTGAAGGAGGAG
AGGAAGGAGGAGAATGGGGCGAAGGTTAAATATGTCACAGGTGCAGACGG
GGTGGTCAAGAAAATGATCAAGAAGGATAAGAAGGATAAGAAGTGTGATA
AACCGGAACCGGTTTCTACGAGGGTTATGGGGATGATGCCTCCGCCACCT
ATGCCCGGAAAGACAGAGAAGGCAGAAGAGGAAGATGAAGATATCGATAT
ATTCGAGGGGGCTGGAACAGAATACAATCCTCTTGCAGGCCTGGACGATG
ATGACGCCTCCTCATCCTCGTCTTCAGAAGAGGAAGGCGAAGAAGAAATT
CATCCAACCAAGAAGGCAAAATCAGAAAAGGTGCCCGAATCTCCCCCAAA
GCCCCCTTCTCTACCTACTTCCCCTTTATCATCACCCTCTGTGCCACCAC
CACCACCACCCGC

Sequences in the Contig:

SY0AAA16YP11FM1 SY0AAC16YD07FM1 SY0AAC41YA05FM1
SY0AAD16YN04FM1 SY0AAD21YA08FM1 SY0AAD53YB18FM1