Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig377
Length(NT) : 1133
Best Gene Model Blast : Link to GSTUMT00012121001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 124 E_value: 2e-07
PFAM Definition: Drf_FH1, Formin Homology Region 1. This region is found in some of the Diaphanous related formins (Drfs). It consists of low complexity repeats of around 12 residues..
Pfam Number: pfam06346 Score: 120 E_value: 4e-07

Sequence:
>Contig377
TTGGGCAAAACGGGGGTAACGCGGGTGCGGCAACTAACAATGCGGGCTTT
GCTGCTATCCAGCAAAACCCCCAGGTCCATGCACAGGCGCAAGCACAAGC
ACAACAACAGAATGAGGATCTTAGTACTGTCCCCTCTCCGCTTCCCGCGA
CTGTCGAAGAGCTCGAGGAGTTTGGGCTCCCATGTTTATCGTTGAGACGG
CTTGAGCTAGCTAATGTGGCTGGTCTATACGTGGACCCTCCTGAGAAGTA
TAGAGGGAAAAAGGAATGGCAATATGCTAAAGAGTGTCCATTCGGGAGAA
ATGTTGGAGGGCTGAATTCTATTGCGGGATGTCTGGGGATTGATGTCGAT
GTGCTCTTCTGCCAGGGTGCGGGCTGCGCTACTAGTTTTGATAATTCAAG
GTGGAGACTCTCGCATGCTGAGGGCGAGGAGACGCACTTTATATATGATG
ACGAATTTGATGTTTCCACTTTAGCCTCTAACCCAAACAACCAGACGGAG
AATCTTTCACAGGCGTCTGGCAGCAGTGCCGCCGCCGGCATGGCGGGGGA
TAGTTCTCATCATAATAATGGATCCAGGAACCCGCGCAAGACCTATCACT
ACCCTCTACCAAGACTTCCGGGCGAGCGTATACTTATCCTAGATGATGGA
AGGGTATTTAGGATTCCCAGGCATGGCTATCCCAGCCCCACCGACAGCCC
AACAACCTCAGCAACAGCAGAATGTTCCAGCGCCAGTAGCCCCAGCCCAA
CTTTTGGCTGCTCCAGGCCTGGGCCAAGGCCAAGGTAATGCACTCAACGT
TGGTCCCGGTGGTGGCGGAGGTGGAGCTGCGGTGGGAGGGGTGGCTGGAG
GTGGGGGTGGTATCGCTCCAAGCAATTCTCAGGGGTGGTCTGCTGGACAG
TTTCTACAGGATCCTGCACAGTATGGTCTGGGTGCGGTGGGGAGTGCAAT
GCCAAATACTAGCGCGCTAGCCCACATATCGCAGATAGCGGGATTGCATG
GTATTCAAGGCCTAACAGCTGTCGCCGATGCGGCATCACAGATAATCACT
GGGGGCGGGACAGGAGCACCAGACGATCCCGCAACGCTTGGCCAACAGCA
GGGGCAGCCTCCCCTGACTCCGAGCCCCGCGAC

Sequences in the Contig:

SY0AAA22YF12FM1 SY0AAA28YO13FM1 SY0AAB11YC16FM1
SY0AAD63YF12FM1