Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3769
Length(NT) : 719
Best Gene Model Blast : Link to GSTUMT00002954001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: DNA-directed RNA polymerase II subunit RPB11a
Accession: ref|XP_749122.2| Score: 388 E_value: 7e-36
KEGG Definition: DNA-directed RNA polymerase II subunit RPB11a, putative
Accession: afm:AFUA_7G03860 Score: 388 E_value: 3e-36
KOG Definition:
Classification: [Transcription].
Kog Number: KOG4392 Score: 345 E_value: 2e-33
PFAM Definition: RNA_pol_L, RNA polymerase Rpb3/Rpb11 dimerisation domain. The two eukaryotic subunits Rpb3 and Rpb11 dimerise to from a platform onto which the other subunits of the RNA polymerase assemble (D/L in archaea). The prokaryotic equivalent to the Rpb3/Rpb11 platform is the alpha-alpha dimer. The dimerisation domain of the alpha subunit/Rpb3 is interrupted by an insert domain (PFAM:PF01000). Some of the alpha subunits also contain iron-sulphur binding domains (PFAM:PF00037). Rpb11 is found as a continuous domain. Members of this family include: alpha subunit from eubacteria alpha subunits from chloroplasts Rpb3 subunits from eukaryotes Rpb11 subunits from eukaryotes RpoD subunits from archaeal RpoL subunits from archaeal.
Pfam Number: pfam01193 Score: 167 E_value: 7e-13
Swissprot: P38902|RPB11_YEAST
Gene Ontology:
GO:0005665 = Cellular component: DNA-directed RNA polymerase II, core complex
GO:0003899 = Molecular function: DNA-directed RNA polymerase activity
GO:0006366 = Biological process: transcription from RNA polymerase II promoter

Sequence:
>Contig3769
TTGGGTCTCCCGCAAAGCAATAGCCACGAGCACGAATCTCAACCCTTCGA
CTCTAACCCCCCCTATAATACTAAATCTCATACATCCTCCTAGTCCACCA
AAAGGCCACCTCTACCCACTAACCTCTCAAGATGAACGCCCCAGATCGGT
AAAAACGCTTCTCTCTCCCATCTCCCCTCCTCTACTCGTTATAGGCAACA
AGTACCCGAACACTGGACTTTGAATCTTCTGGGTGCACTGATGCGCGCAA
ATGATTGATTATCACATTTATTTAATCCTGTGTTCGGATACTTTTGTCCA
TAACGAGTACCTCACGTTCCAAAACAGTACTCACCAATGACTAACAACCG
CCCCCATCCCCCACCTCCAGCTTTGAGCTCTTCCTCCTCGGCGACGGCGA
GACCAAAGTCTCCATGGAGCAGGACACACGCCAGCCCAACGCGGCCATCT
TCACCTTCAACAAGGAGGACCACACACTGGGCAACCTGCTGCGCGCCACG
CTCCTTCACAACGAGCACGTCGTATTCTCTGCGTACAAGGTGCCGCACCC
GCTCTTCCCGAAGTTCGAGCTGCGCGTACAGACGGACGAGGAGACGACGC
CGAAGGAGGCGCTACTAGCGGCCTGCCAGAGCCTCATTGGCGACCTACAG
ATGCTCAGTCAGAAATTGACGCGGGAGTGGGAACTTAATAAGATTGCGAG
GGATACTAGTTAGCTGGAT

Sequences in the Contig:

SY0AAC16YB16FM1 SY0AAD25YJ06FM1