Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3768
Length(NT) : 1076
Best Gene Model Blast : Link to GSTUMT00002917001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: AAA family ATPase Rix7 (predicted)
Accession: ref|NP_595792.1| Score: 714 E_value: 2e-73
KEGG Definition: hypothetical protein
Accession: spo:SPBC16E9.10c Score: 714 E_value: 1e-73
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0733 Score: 694 E_value: 1e-73
PFAM Definition: AAA, ATPase family associated with various cellular activities (AAA). AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes..
Pfam Number: pfam00004 Score: 398 E_value: 2e-39
Swissprot: O14325|YB7A_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005524 = Molecular function: ATP binding

Sequence:
>Contig3768
TTGGACTACGTACTGTTGGGGACGTAATCGTCTTTGCAGCTGCGGAGACA
TAATTATGCATCATTTCTTGGAGGATCGCGGTGCTGGGGAAACTGTTACG
AATACTTACGATTCAGGGGGTATCTGGTATAAAGGAAGGGTGTTTTCCCT
TGTGATCAAACAGCAGGTCAATCAAGACTTGACATATTTTTACTTGCTTT
GCAAACTTATTTATTTCTCTTCCCTCGCCTCCCTAATTATCCAAAACTGC
TTCAGGGTGGAGATAGCCTGCTTCTCTTTCTCTCCAGACGGATCTGCCGC
AGCACACTGCAAAGACTTTTTTCTCTTCCCTATAATCACAGGTTGGCTAA
AGGCAGCGACACAAACACCCTACAACTCCATTTCAGAATTTAAATTATAC
TAACACTCAAGCCTCCACTAGGAGTCAGATACGATTAACAAGCGAATAGC
TGGAAACACCATAATGGCATCGCCGGCACCCCAGAAACGAAAGGAACGCC
GGCCGGTCGAAGATGGAGAATTAGTAAAGCGTCAGAAACAGAACAACTCT
CGCGAGCCACCCAAGGACATCTCCCTGCAGGACATTGGCGGCAGAGAAGA
GGTTGTCGACGATCTTTTGAAGTTTATGACTATGCCTCTAACCCACCCAG
AGGTTTACCTTCATACTGGAGTGGACTTGCCTCACGGTGTACTTCTCCAT
GGACCACCTGGCTGCGGAAAAACTATGCTAGCAAATGCTATTGCCAGAGA
GGTTGGGCTACCATTTATTGCCTTTTCCGCACCCTCAATCGTATCAGGAA
TATCGGGAGAATCGGAAATGAAGCTAAGGAAACTTTTTGAGGAAGCACGG
GAAATAGCCCCTTGCTTAATGTTTATGGGTGAAATAGACGCTATAACACA
GAAGAGGGACAACACCCAGCGGGATATGGAGAGAAGAATTGTTGCCCAGG
TGTTGACCTGTATGGACGATCTCGCATTGGAGAAGACTGGTGGGAAACCT
GTCATGATCATTGGAGCAACAAACCGACCCGACAGCCTAGATCCAGCATT
GAGAAGAGCTGGAAGATTTGATAAGG

Sequences in the Contig:

SY0AAC16YB14FM1 SY0AAD44YP18FM1