Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3767
Length(NT) : 1882
Best Gene Model Blast : Link to GSTUMT00010828001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59977.1| Score: 1189 E_value: 1e-128
KEGG Definition: tyrosyl-DNA phosphodiesterase
Accession: aor:AO090026000547 Score: 1189 E_value: 1e-128
KOG Definition:
Classification: [Replication, recombination and repair].
Kog Number: KOG2031 Score: 661 E_value: 1e-69
PFAM Definition: Tyr-DNA_phospho, Tyrosyl-DNA phosphodiesterase. Covalent intermediates between topoisomerase I and DNA can become dead-end complexes that lead to cell death. Tyrosyl-DNA phosphodiesterase can hydrolyse the bond between topoisomerase I and DNA..
Pfam Number: pfam06087 Score: 552 E_value: 5e-57
Swissprot: Q8BJ37|TYDP1_MOUSE

Sequence:
>Contig3767
TTGGCTAAACACTCTCGGTCTCTCAAGAGGATACCAATAATGTCGAAAAG
AGCCTCGCCACGCGAACTAGAATCCCTACACGCTCCAGTTTCTCCTCCAA
TGCTGAAGCGAAAAGCGCAGTCTCCAACTCCACCATCGGAAAAGAGGTTG
AAGGAGGGGAAGGCACGAATGGGGCCTGAGGATGAAGGCAGTAGCGACTT
GATGGCTGTTAAACCGAGGATAAGGGTAGCTTCACCCTTCCAACTCACGA
GAGTTGACGAATTACCCGAGAGCGAGAATGTCGACGCGGTGGGAATTAGA
GATATTCTTCGCAGAGGTCCACTCAAGGAGGTTTGGATATTCAATTACTT
GTTTGACTTGGATTGGGTTATGAATCAGTTTGATCCTGACGTCAAGGACA
CAGTGAAAGTGAGAATAGTCCATGGGAGCTGGAGACGGGAGGACGCCAAC
CGAGCTCGAATTCACGACCAAGCGGAGAGTTATCCTAATGTCAAGCTTGT
TTGTGCCTTTATGCCTGAGCCCTATGGAACCCATCATTCTAAGATGTTTG
TTCTGTTCCGGACCGATGATCATGCTCAGATCATAATACACACCGCCAAT
ATGATCCCGTTCGACTGGCAGAATATGACACAAGCTGTCTGGCAATCTCC
ACTTCTCCCCCTCTTACCCCAAGATCATGGATCGCCTCGCGCCCAGACCT
TTAAACCCATTGGACAGAGGTTCAAGACCGATATCTTGGCCTACTTCTCG
GCTTATGGCGAGGGGAGGACAGACTTTCTCACTACACAGCTTTCGAGATA
CTCTTTCGATCCGGTCAAAGCAGTATTTGTCGGTAGTGTCCCCGGGAAAT
TCCACATTGACGCATCCAACGGGAAAGGCTACGAATGGGGTTGGAGGCGA
TTGGCCAGTGTCCTTCGGAAGGTGCCCCTTCGAAGTCCTGAAGCCAAAGG
CTGCATAGTAGTCCAAGTGTCCTCTATTGCTACTCTCGGATCAAAGAACA
CATGGCTTTCCCCAGTCCTATTTGCAAGTTTGAAAACGAGCAGGTTCACA
GCATCCGCTGAGCCAAAATTCCACGTGATATTCCCCACGGCCAACGAAAT
CCGCGAATCTCTAAATGGATATAGAAGTGGCTCATCTCTGCACATGAAGT
TTCAGTCCCCAGCACAGCAGGCACAACTGGGGTATATGCGGCGACACCTC
ACACACTGGGACTCGAACCCTCCACCGAATACTCAGTCCTCCTCCTTCTC
CTCCTCCTCCTCCTCCCCCGCTCTCAAGGATGCAGGAAGGGCGAGAGCAG
CACCTCATATAAAAACCTACATCCGCTTCTCAGACACCGACTGCACGCAG
ATTGATTGGGCCCTTCTAACATCAGCAAACATTTCTATCCAAGCCTGGGG
CGCCGCAGAGAAGGACCCGATAGGAAGAATTAACCACAGAGAAGTGCGCA
TCTGCAGTTACGAAGCAGGGGTTCTGGTGTACCCTGAGATCCTAGACGTG
GAAGAAATGGTGCCGACATTTAGGAAGGATATCCCGGATGAGATTGGAGA
TGGGGGAACAGCGGGGTTGAGGATGCCGTATGGGTTGCCGTTGCGGAAGT
ACGCTTCAAACGAAATGCCGTGGTGTGCTTATAAGAGTTATTCGGATGTG
GATTGGTTGGGACAACGTTGGGAAGCGTGATTGACGGAGTTGGCGTGGGG
TGGACTGAGAACTTGCATCACACTGTGTTTTCTCATGATTTCTGGCTCTG
GTTGCTCTGGAAACATGAAGTGTGAGAGGTGATTAATGTATAATAGTTTA
CTGCATCATGTGGGATTTGCTCGGGCTTTTTAGGTGGGTACGGTGTTTGC
TAGACCTGATACAATATATGACTTATGGTATG

Sequences in the Contig:

SY0AAA1YP07FM1 SY0AAC16YB13FM1 SY0AAC22YP06FM1
SY0AAC22YP06RM1 SY0AAC30YE12FM1 SY0AAC43YK13FM1
SY0AAC45YO06FM1 SY0AAC4YP22FM1 SY0AAC54YB05FM1
SY0AAD15YL09FM1