Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3766
Length(NT) : 1581
Best Gene Model Blast : Link to GSTUMT00005776001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SNOG_10779
Accession: ref|XP_001801039.1| Score: 146 E_value: 3e-07
KEGG Definition: hypothetical protein
Accession: ang:An15g07040 Score: 145 E_value: 2e-07
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1676 Score: 183 E_value: 3e-14
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 210 E_value: 2e-17

Sequence:
>Contig3766
TTGGCACACGGCGGAGTGCCGGTTCTTAGGGCGCAAGTACTTGAGGACAG
TATTACAAAGGAGGAAGAAGACAAGGGCAGTTGTCCAGCTGAGAAGAAGC
CCGAGGTGAAATTTTCTACTGCACGAGCACACCATCCACCAGTCCCTGAG
TAACTCAGGGCTTGATGGGGCCCTTGCATCACCCACATTCCAAGATTGCC
TACGTCACTCCCCCGCCCATGGAAGTTGGAGCTTAAAGAAAAAGGCTCCC
TCACCCCCCCACCCCTCTTTTGAGTCTTGGGCCTCTTTCCCATAATCAGT
CTGTCGAAATAATATCTCCGAGCGAAATATGGGGAAATCCAGTAAATATC
GTTCTAGTTCACGCTCACCCGAGCGTCGCGATGAGGATGATTATCGTTAC
GAAAAGCATTCTAAAAAGAGGTACGACGGGGGTTCGGGCCGTGAGTATTC
TGGTGACGAGAAGCCTGGTAGGGTCAGAGATGGTGAATATTACCGCGAGA
AGGGACATAGGAAACGTGAGAAGGAGGAGAAAAAGGAGAGGAAGCGCAGG
GAAAAGGAAAAAGAAGATAGCGGGGAATACGGTAGCCCTGGGCGCCCTCG
GAGTCGCGAACGAAGCACACAAGAACAGAATTATCAACCTTCACCTCACG
GACAGCATTATGGTGACCAGCCTGGACACGGATACCAAGCTCCACCGCAT
GAGAGTGGATATCCGGCGACAGGCTCTGAGCACCCAGGTCACCAACCGTC
CTCGTACGGACCCGGTGTCTACACTTCGGCCGGGTATCAACCTCCGCCGC
CTGCGCAAGGCTACCCACCCGCCTCCCCAGGCTATGGGGGGTTTCAAGGG
CCACCAGCACCTCCTCTCTATGCAACGGGAGGCTTCCAAGGATATCCCCC
TCCTCCTGGCCCACCCCCCACTTCGCAACAATACGGCGGATATAGCAGCG
GAAGTGCACCCTACAGCTATCCTCCACCTCCACCGCAGCAGGAATATGGG
GGATACGCGCAAGGAGGGCACGGACAATCGCAGTATCCGGCTCCTCCTCA
CCAGTCTCCCCACCAACCTCTAAACCACCCCGCTGTCTCACAGGGCGGTC
CAGTATATGTATCGTTGCCTCCACCACCAAAAGTCACTGCGGGTGGAGCT
ACCGCAGGCCAGCACTACAAACCTCAGCATCATTCGGCTCAACAGCAGCA
AGCATATTACGGGCACGACTCGGGAACAGTCGACTACCCAACTGGCGGCT
CAACAGCTGTTCAATTTGAGAATACTAACCCCGCCAATCCTCATTCCAAA
CCTTCTGCTGGTTCTGGTGGCTCCGCAGTTTCTGCACTCGAGACCTTTAC
CGGTGCGCTCACCAGTTCGCTACACTCGTACGCCCGTACTCTTTTCCCTG
CCACAAGCGCCCACAAGCCTGTCGCCCAGTATGGTGCCCCGGGCGAGAGC
GGAGCCCCGGCTCAGCAAACAGAGAATAGGTTTGACTCGTTTGCCCGGGA
AAAGACTGGAAATGGAGTAAAGTGGTATGTTGATGGAAAAGATTATATGT
ATGCTGTAAGCATTGCCATAGAGAATGCTCA

Sequences in the Contig:

SY0AAA5YJ08FM1 SY0AAC16YB08FM1 SY0AAC24YO07FM1
SY0AAD28YC23FM1 SY0AAD29YH03FM1 SY0AAD31YN01FM1