Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3765
Length(NT) : 787
Best Gene Model Blast : Link to GSTUMT00002456001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein NCU03505
Accession: ref|XP_955807.2| Score: 625 E_value: 3e-63
KEGG Definition: hypothetical protein
Accession: ncr:NCU03505.1 Score: 625 E_value: 1e-63
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0955 Score: 196 E_value: 4e-16
PFAM Definition: No Hit Found
Swissprot: Q8VCD7|JHD3C_MOUSE

Sequence:
>Contig3765
TTGGGGGAAGCCGGTGAAGACTAAAAACCACAAGAAGAGGAAGCTCGAAG
ATGGAAAGGAGCGACCTGCTAAGGTTAAGAAGTTGCGGTTGAAGTTGAGC
AAAGAGGCTGCCCCTGAGCCGTGTATTCTCTGCCCTAATAATATTCCATA
TGAAGAGTTGGTAGCTACAGATGATGGCCAAAAGGCTCATAGGCTGTGCG
CTATCTATACGCCTGAAACCTACTTCAAATGGGATGAGGCTCAGCAACAG
GAGGTTGTCGCAAATATCCCCGGAATCCCGAGGGCTCGGCTCGAGCTCAG
ATGCATATTCTGCCGATCAACAAAGGGTGCCTGCTTCCAATGCTCCTCCA
AGAAATGCGCAAGAGCGTATCATGCTACCTGCGCTGCGGCAGCTGGCGTC
CTGGTTAACATGTTTGACGTTCCTCACTATGGTGAAGATGGCCAGATGTA
TCCACAAACAGATATCGACTTCCGTTGTAGATTTCATAGGCCCAAGCGTC
CCAAGGGCATGGATAGCGAGAAATTAGAGAGCGATATGGTGGTACGGAAA
TTTGCTAACAGTCTCATTAAGGGTGATGTTATCCAGATGCAGTATTACAG
GGGGGACATCTTTGGCGGTGTGGTCATCGAGAATAGATACAGTGAGGAGT
GTGTGGTGGTCAATGTCTTACCAAAAGGGACTGAATCACTGGAAGTTGAA
TGGAAGTGGATATTGGCTCAAGATCCTTCAACGGTTCCTCTGCCTTTGCC
ATTGACCGAGATGCCTATGTATCCAACGGCACAACAA

Sequences in the Contig:

SY0AAC15YP19FM1 SY0AAD52YI20FM1