Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3764
Length(NT) : 1037
Best Gene Model Blast : Link to GSTUMT00006417001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: AMP-binding enzyme (Fum16), putative
Accession: ref|XP_001260479.1| Score: 760 E_value: 9e-79
KEGG Definition: fatty acid activator Faa4, putative [EC:6.2.1.3]; K01897 long-chain fatty-acid-CoA ligase
Accession: afm:AFUA_2G09910 Score: 759 E_value: 6e-79
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1180 Score: 713 E_value: 6e-76
PFAM Definition: AMP-binding, AMP-binding enzyme..
Pfam Number: pfam00501 Score: 222 E_value: 5e-19
Swissprot: P30624|LCF1_YEAST
Gene Ontology:
GO:0005811 = Cellular component: lipid particle
GO:0005741 = Cellular component: mitochondrial outer membrane
GO:0004467 = Molecular function: long-chain-fatty-acid-CoA ligase activity
GO:0005515 = Molecular function: protein binding
GO:0006629 = Biological process: lipid metabolic process
GO:0006869 = Biological process: lipid transport
GO:0006499 = Biological process: N-terminal protein myristoylation

Sequence:
>Contig3764
TTGGCTTGGGACAATCCCTGCTTGTGCTGAGATCAAGCTCGTAGACTATC
CGGAGGCTGGTTACTTCACCCATAATAATCCCGAGCAGGGTGAAGTTTGG
ATTCGTGGCGATTCGGTCGCATCGTCGTACTTTATGAATGAGGCGGAGAC
TGCGGCAGCCTATGAGGGTGAATGGTTCAAGACCGGGGATATCGGTGAAT
GGGATTCGAATGGCCACTTGAAACTCATTGACCGCAAGAAGAACTTGATC
AAGACTCTGAACGGAGAATACATTGCTCTCGAGAAGCTTGAATCGGTTTA
CCGTGCGTCAAGCATTGTTGGAAATATCTGCGTTTATGCCGATGAGCAAA
AGACCAAGCCTATCGCTATAATTTTCCCCGTCGAGGCGGCATTGAAGAAG
CTTGCCGCCGAGAATAGCGTCGAGGGAGAATTTGAGCAGCTTGTCCACGA
TGCCAAGTTAAACCAGATTGTTATGAGGGAGCTTACCGCCGCTGGGAAAA
GGGGTGGGCTTGCCGGCATTGAGTTGATTGAAGGCTGTGTCTTGACCGAC
GAAGAATGGACCCCCCAGAATAGCTTGGTGACTAGTGCTCAGAAGCTGAA
CAGAAAGGGGATTCTTCAGAGGTATCAATCGGAGGTTAACAGGGCGTATG
GAGGTTCATAGATGGATCGTTCACGGATGAAGGTGTGCAGGCAGAACTGT
GGTTAATGCTTTGTCTTCTTGTCGTTTTTATTATCATCATTATTTGGAGC
TTGATTCACTATCACCCTTTTTTCCTTCTTTCCTCTTTTTCGATAGCGTT
GCCTTTTTTTTTAGTTGAGTCCACTTGCGGATGAGCGTGATGATGCTGTG
TTGGCGGGCTGATGTGATGGGGCTTTACTTACTTCCCGAGAGTCTGTTTC
TGGCCCGGTTTTCACGTTGTCGCGCTTCCCTGATTTATATTCTGAGTAAT
TGGCATACTTCCGTTTGTTTCAGTAGTCGTTTTCGGCAGCGGCGGGGTGT
GGGGGCTTGGTGCTTGTCGGGGGGAGAGGGGAGTACT

Sequences in the Contig:

SY0AAC15YP13FM1 SY0AAD62YC01FM1