Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3763
Length(NT) : 2075
Best Gene Model Blast : Link to GSTUMT00008547001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: DNA helicase
Accession: gb|EDN62268.1| Score: 446 E_value: 6e-42
KEGG Definition: RRM3, RTT104; DNA helicase involved in rDNA replication and Ty1 transposition; relieves replication fork pauses at telomeric regions; structurally and functionally related to Pif1p
Accession: sce:YHR031C Score: 446 E_value: 3e-42
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG0987 Score: 226 E_value: 5e-19
PFAM Definition: No Hit Found
Swissprot: P38766|YHJ1_YEAST
Gene Ontology:
GO:0005724 = Cellular component: nuclear telomeric heterochromatin
GO:0005657 = Cellular component: replication fork
GO:0004003 = Molecular function: ATP-dependent DNA helicase activity
GO:0006260 = Biological process: DNA replication
GO:0000002 = Biological process: mitochondrial genome maintenance

Sequence:
>Contig3763
TTGGGGAGGGTTAGGGTAATACGGCAAGCCAGGAGCCTCACAATGCTTGG
CGGTGTATGTTGGCCGTGTGCCTTCTCCAGCAGCTTCCCTCCAACCCTAA
CAACCTCCTCACTCTTGGATCTTCTGTTTACTTTTGAAACACCCCACGAT
ATAGCTATTCCTTCACCTTACCGAACTCGCTGTCACGAATATATATCATT
CAATTCTCTTAAACGACTACTCTCCCAAAACCTCACTCCTTCACCCGAAA
AAATGCCACGGGGTTCTGCTAAGGGGAAGCGTCAAAAGCAAAAATTCTAT
GCAGTATACAGAGGCCGAAATGCCGGAATTTTTGACGATTGGTGGCCTTT
TTCTACATTCCACCGGCGATCCTTTTGTGGCTAATTTGCAGGTGACAGGA
ACGAAACCAGATTACAGGTTGAAGGATTTTCCGAACCAATCTTCAAGGGC
TTTACCTCGCACGCCGAAGCAGAGTCTTGGATCTATGAGCAACGTGACAA
GGAGATCCGCGAAGAGAATGCTCGGTTACGGATGGAATACCCTGATACTG
ATGAAGATGAGTCGGGAACCGGGGAGCAGCGCGGTAGCAGTTGTCCGCAG
TTCTCTCAAGATGATACCGGGTTAAGGGTGAATTACCCGGACCTGGACGC
CCTACCTGCTCGTTTGAGCGCCTATGGCGGTAATGGGGCTGGCGCGCCTT
CCTACGTCTCTACCCCCTTAAACACCCCCTCCTCCTTCACTCCAAAACCG
AGTCCTGAAGCTTTACCCCGTCTCGACCGTGATCAAAAGTGTGTTCTCTC
CCTAGTGGAGCAGGGGCATAATGTGTTTTTTACGGGCCCGGCAGGCTCCG
GCAAATCACTAATTTTGAAACATATTAAGAATTATCTTGATAGCATAGAG
AAAACTTATGCTATAACTGCTCCAACCGGGATTGCCTCGGTACTCATTGG
TGGTCAAACTATCCACTCATGGAGCAGGGTTGGGAAAGGGGACAAATCAA
TAGTTTATTATATAAACAAGTCAAAAAGCACCGTCAGGCATCCCGAGGCC
AGGTCGCAGGGTAAGCCCGCCAAGTCGAGGGAGGCACCTTGGAAAGAGAC
ACAGGTTTTAATCATCGATGAAATCTCCATGCTATCTCCAGATCTCTTTG
AGAAACTGAGCGTGATAGGCCAACATGCAAGGGGCGATAATGGGTGTCCT
GTGAAAGCTCCCTTCGGTGGCATGCAGCTCGTTGTGTGTGGGGATTTCTT
TCAGCTTCCCCCAGTCGAAAAGGATTCGGATAAGACATGCTATCAATGCG
GGTACCCTATCACACCTCGCGAGGAACGCTCCTATCTGCCACCCAATCAC
GATTACATTAGAACGAGCGTCGAGTTCCTGGACGAAATCCATGCTTTTCG
AGTCGATTCTTCCCGATGGTCCCACTGCTCTAGAGCCGACCGCAGTGGAA
GAATGTGTAGCCATCTCTGGAATGAGACTGTGAAGTACTGTTTCCAGACC
CCAACCTGGTTCAAAATAGGATTTAAGTCGATCATTCTTACGAAGGTCTT
CCGACAGCAGGACAAGGTTTGGTTAGACATGCTTGGGAAATTGAAGGTTG
GCCATGTGACTCCAGAGATAATGACTTGCCTGTTAGGCCTTCGGCGGCCT
CTGGGTGAGCTAGCAAGTGGCGTTAAACCTACAAGGCTTTATACGCACAG
GAATACAGTGGTCGATGAAAATGAGCAAGAATTTAAGAAGCTGAAGGCCA
CCGAGTACTATTTTGATGCCATTGATGAAGGCACCATCAAAAATGCTAGG
TACCGGAAAACATATAACTCTCAAGAGCTTAGCGAATTCAACTTTTTTAA
AAACCTTCAGGTTCAAAAGGAGATTAAACTCAAGCACGGTGCCCAGGTCA
TGTTGCTCTTTAATATCGCACAAAACGAATGCCTAGTCAATGGCTCCCGG
GGTGTTATTAGCGGTTTTCAGCACATGAACTTCAATACCTTCACGTCCGG
CCGTGTCGCCCGCGATTTCGAGCGTCCCATGCTGAAGAAGTACTTTGAGT
TCAAGCAACAAGACGGGAGAGTGCG

Sequences in the Contig:

SY0AAA20YB21FM1 SY0AAA3YG05FM1 SY0AAA49YG23FM1
SY0AAC15YP10FM1 SY0AAC61YO24FM1 SY0AAD29YH07FM1
SY0AAD6YI06FM1