Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3762
Length(NT) : 1592
Best Gene Model Blast : Link to GSTUMT00005154001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein An15g00660
Accession: ref|XP_001396605.1| Score: 668 E_value: 8e-68
KEGG Definition: hypothetical protein
Accession: ang:An15g00660 Score: 668 E_value: 4e-68
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2300 Score: 161 E_value: 9e-12
PFAM Definition: No Hit Found
Swissprot: O94459|SSL3_SCHPO
Gene Ontology:
GO:0032116 = Cellular component: cohesin loading complex
GO:0000794 = Cellular component: condensed nuclear chromosome
GO:0005829 = Cellular component: cytosol
GO:0005515 = Molecular function: protein binding
GO:0034087 = Biological process: establishment of mitotic sister chromatid cohesion
GO:0034184 = Biological process: positive regulation of maintenance of mitotic sister chromatid cohesion
GO:0008104 = Biological process: protein localization

Sequence:
>Contig3762
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCGAAGCTATGGTCAGGCTACGATATGCTGGGATATTACATGAG
GAGACGGAGAATGGGGATGAAGCTGAAGATGCTTTAAATAAAGGAATTAT
GCTAGCGCAAAGGGGCAACTTCACCGATATCAAATACACCATGCAACATC
TTCTTGCGCGTATTATGCTACGAACCACCCCAAAAGCTTCTCTAAAGATG
CTCAATTCCTGTATTGCCGACTCGGAGACCCTCGATATGGTCCACTGGAC
ATATTCGTTCCGATTCCTTCGATGTAATATCCTGATGGAGGATTCCCCAC
TACACGATGAGCAGGGCGCAATAACTACTCTTCAAAAGATATCGGGTACT
GCAGCCGCACGTCATGACCACGGGATATATCTACTCGCAAGCTTAATGGA
GACAATGATCTCGGTTTCTTCTGGGGCTGACGGAATTGAGGCGGCCAATC
GTGCGTTGGCAAGAGCGAATTCTTTACAGCTGGAAAGTATGCAAGGGATG
GAGCAATTGGGTATCTTACGGCAAATGTTGGATATCATGTGCTCACTCAT
GGCTGGGCGCTATAGCGAGAGCGAGGTAAAGGTCAAGGTACTGCACGGAA
TGCTCGACCATAGTTCAAAGGCCCAGATATGGACGCCCAGTGGGGAATTT
GAAATATTAATTAATCCCGTGCGGCTCGGGAGACCCGAGGAAAAACTAAA
GTTCAAATGGTTGACCAAAGAAGATATTTTCGTGTTGGGATACTTCATTA
GCGGCCTCTGCAAGTTCCAGAAAAATGTCGAAGAAGTGGGGCGCGGGGAG
AAATACCTGCAGGAAGGCCTCAGGTCTATAGAACGTCTATTGAAGGAAGA
TCCCGCTGGCACGACCTCGCTTGTGGGGGCTATGAACAAGTCTACATGGA
GGCAAACGCTGAAATGTCATGTTATGCTCTACCACACTTTCCTCCTCTGC
GTGAGAACAGATTGGGACGGCGCTATTAAGGGATTCAACAACCTCCAACA
AGCCTTCTCGGTGCTACCACCTCAAAGATCCCTCCTACCAACACTAATCA
CCTACCTACAAGCCGTAATATCCCATGGCACGAACCAATTGGACCAGGCC
CTAGAGCTCTATAAACTAGTCTACACGACTGTCCAATCTCCGGATTCAGA
GATATCAATAATCTCCAAACTGAACTCCATCATAATTCTCCGGCCGCGCG
ACTCCCGTGCAGCAGAACATTTGATGACTACGGTAGAGAAGCCCTGCACA
TCGACCAAAAACTACCTCATGAAGGCGGCGTACATGGCCGTCAAAGCCAC
GGAGCGAGGCGAGCTGGTCAAGACAAAGAACTACCTGAGTTTGGCCCTGC
AGCTTGCTACGCAAACAACGAATCAGCAGTTGACATTCATCTTGCTTAGC
TTCATGTGTCACAGATTCTTTTCGGGCGTAGTTAGCGAGCAGGCTGAGAA
AAGTGCTAGGGCAGCGCTGCAGAATGCTGCGCGTGGGAGGGATAGCTTGT
GGAGTCTTATGGGGGGTGAGATGTTTGCTGACTGCCTGGCGA

Sequences in the Contig:

SY0AAC15YO23FM1 SY0AAC1YF19FM1 SY0AAD46YG02FM1
SY0AAD59YI19FM1