Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3760
Length(NT) : 1771
Best Gene Model Blast : Link to GSTUMT00005050001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein BC1G_06328
Accession: ref|XP_001555198.1| Score: 696 E_value: 5e-71
KEGG Definition: hypothetical protein
Accession: ang:An01g06620 Score: 678 E_value: 3e-69
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3760
TTGGGTGTTGGATACACTTTGTTCTCCATCTCCATCTCCATCTCCATCTC
CTTCCTCTATACCCAACTTGGTTTAGTTCATACTCGTATTGTGCACAGGA
TTCTTGCTCTTGTTTGCTCAGGGGGTTAACCATGCCCTGGCTTACGCTCC
TTCGCAGTTCGCTATTGCTGCTGCTAGCAGCAGCAGTTTGTGAATCTCAA
GATACTCCGATATTTCCAGGGCCTTGGGAACGCTACATTCAAGCACCGGA
ATCTCGCCAGGTCCGTCCCCGGAAAGTTTACTATACTGAGGGCACTGTTT
CTGCTGCTACCGACTCGTCAGGCGTTACGGTTTTGAAAGGTCAGGGTGCC
TTGGTGACATACGAGTTTGCTCAAAATATTGCTGGACGCCTTTTTTTCGA
AGTTGATTCGGCCACAACGAGTAAACACCAGTCCATTGGTATCGCATTCT
CTGAATCCCCTCGATTTATCGGGCGAAGAACCGACGGAACCGGTGACAGG
GTCGAGTACGATCTTACCCATTTTCAGCCCCTGACAAGTGGCCTTAATTC
ACTGGACCAGGAACATGTTCGCGGTGCATTCAAATATGTCACGCTTTTCA
TTCCTCACCCGAGGGATCCAAAGGCTGGTCAGGCTCTCCCGCACATCGCT
TCACTCACTACCAAGTCCATTGCAGCGGACCTCTCAGATTTGGCGCAGAT
GGACTTTGGGACACGTGGCGGACAACAGCCCCTGCTTCCTGTTGAGAGTG
TCGGTTTCAAAGATGTCTGGGTCAAATATTCAGCTTTCCCGTCGCACGAA
AACCCACGTCGATACACAGGGTATTTCTATTCGAACGATAATCTTCTCAA
CCGTATTTGGTATGCCGGGGCTTACACACTTCAAATTACCACAATCCCGC
CGAAAGAAGGGGGAACTCTCATTGATTTGAATAAGGTGGTTGATCATAAT
AGAGCACCACATGGAACCTGGTACTCCAATTTTACGATATCCAACGGGAC
CTCCGTAACCACGGATGGTGCTAAACGCGACAGGATGGTCTACGCAGGAG
ACATGACACTTGCCGCCCCTGGGATAGCTGTCTCAACTTACGATCTAGTT
TCTGTCAAGAACGCTCTTGACACCCTTTTTGAACACTATTATCATAGTTC
TCATGAGGAGGGTGGTAAGGGTAGTGGCATGATCAGATTACCTTATGCGG
GTCCACCTATGGGGTTCCGTTTCGAGTTCAGCGATACATATCACATGCAT
GCACTTCTAGGTGTTTACCAGTATGTGCTTTATAGTGGAGATTTCGATTA
CTTGAAGCACTTGTGGTGGAAGTACGTCCAAGCAATCGAATATTCGACGT
CAAAAATCTTGAAGCATACTGGTTTGATGTATGTTACCTCGGGCAACGAT
TGGCTCCGGCCCGGCATGGGGAGGGAGAACATTGAAGCTCAGGGAATTCT
TCTCAAAACCCTTTTCGGTAGCGTCAAACTTGCAGAGTGGTTGGACGAAG
ACGGCTATAAGTTCAAGGATGTCAAAGGACGGGATCTTAAACAGCTTATC
ACTCTGTGGGAGGGGTATATGGCGGGTATTAAGAAGGGAGTTATGGCCCC
CGAGAAGCTTTGGAATGGAACTGTTGGACTGTTCTGTGACAACCCCGAGG
ACAGGCGGGATATCTTCCCCCAAGACGGAAACAGTTGGGCTGTTGCAACG
GGTCTTGTCACTGGAGGTATTGCCCACCGGATTAGCAGAGAGTTGAAGAA
CAGATGGGGAACTTATGGAGC

Sequences in the Contig:

SY0AAA38YK19FM1 SY0AAC13YD02FM1 SY0AAC15YN22FM1
SY0AAC21YI11FM1 SY0AAC28YE04FM1 SY0AAC29YE04FM1
SY0AAC29YK09FM1 SY0AAC55YO03FM3 SY0AAD27YN18FM1
SY0AAD62YF12FM1