Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig376
Length(NT) : 802
Best Gene Model Blast : Link to GSTUMT00008711001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 110 E_value: 4e-06
PFAM Definition: No Hit Found

Sequence:
>Contig376
TTGGCATACCACTTCACCGGACTGGAATCGTCAACTACCGGCAGTTAGGT
TACCCGGGCAGGTATAACTCGTGGAGATGCAGAATGTCATGTTAGGGGGT
ACGTTATCATAACCGATGGGGGAGAGTGTTGGGGCCTTGTCCCAAGTACC
GTACGTTATGATAAGTGCAAACACGCTTGACCAACACCGATAATCTACCT
ATCATACCGGTATTCATTCAGCCAACTCGACTCCACCGCTTCCAAGCCGA
ACTATGGCATCCCCCACATATGCTATATATGCACGGCACAGCGCGGAAAA
CAAAAACAAAAGTACCAAAACACCGTCCCTACCCGAGCCAGTCAACTCCC
CCCCAACTAACTAACCTTTTCCAACTGTTCCTGATATCATAACCACCGTA
CAAAGCCCCCCAACAACCTCCAATCCAAATGCCCCAAACAACAAGTCCAA
TCCTAATCTCAATAACCGGCGGTGAAGCCGCTGGAAAAAAGGCCGTCCAG
GCGGGACTAAAGTCCCGCCTGCTATCCCTGAACGGCGAACTGAAGATATC
GACGCTGCACATGGCCGACTACGCACTCCCGCCACTGCTGCCGTGCACGG
GGACGGCGGCGGAAGGGGCGAAGAGGTACGATCTTGAGCGGTTGGCGGGG
GAATTGGAAGGCATCGTTCGCGGGGATGTGGAGGAGGCGGAAGTGGACGT
GGTCATTGCGGAGGGGCGGTACATGCTCTGCTGTTCGCGGTTGGTGGAGG
TTGCTGGTGTGAAGATATTCGTGGATTGCGATTCGGACGTTAGGCTTGCG
CG

Sequences in the Contig:

SY0AAA22YF06FM1 SY0AAA46YO04FM1 SY0AAB56YP17FM1