Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3759
Length(NT) : 869
Best Gene Model Blast : Link to GSTUMT00006251001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein CIMG_02556
Accession: ref|XP_001248785.1| Score: 683 E_value: 6e-70
KEGG Definition: cell cycle control protein
Accession: aor:AO090012001026 Score: 651 E_value: 2e-66
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Transcription, Signal transduction mechanisms].
Kog Number: KOG2952 Score: 678 E_value: 6e-72
PFAM Definition: CDC50, LEM3 (ligand-effect modulator 3) family / CDC50 family. Members of this family have been predicted to contain transmembrane helices. The family member LEM3 is a ligand-effect modulator, mutation of which increases glucocorticoid receptor activity in response to dexamethasone and also confers increased activity on other intracellular receptors including the progesterone, oestrogen and mineralocorticoid receptors. LEM3 is thought to affect a downstream step in the glucocorticoid receptor pathway. Factors that modulate ligand responsiveness are likely to contribute to the context-specific actions of the glucocorticoid receptor in mammalian cells. The products of genes YNR048w, YNL323w and YCR094w (CDC50) show redundancy of function and are involved in regulation of transcription via CDC39. CDC39 (also known as NOT1) is normally a negative regulator of transcription either by affecting the general RNA polymerase II machinery or by altering chromatin structure. One function of CDC39 is to block activation of the mating response pathway in the absence of pheromone, and mutation causes arrest in G1 by activation of the pathway. It may be that the cold-sensitive arrest in G1 noticed in CDC50 mutants may be due to inactivation of CDC39. The effects of LEM3 on glucocorticoid receptor activity may also be due to effects on transcription via CDC39..
Pfam Number: pfam03381 Score: 449 E_value: 2e-45
Swissprot: P25656|CDC50_YEAST
Gene Ontology:
GO:0000299 = Cellular component: integral to membrane of membrane fraction
GO:0005770 = Cellular component: late endosome
GO:0005802 = Cellular component: trans-Golgi network
GO:0051666 = Biological process: actin cortical patch localization
GO:0006897 = Biological process: endocytosis
GO:0000080 = Biological process: G1 phase of mitotic cell cycle
GO:0045332 = Biological process: phospholipid translocation

Sequence:
>Contig3759
TTGGATAGCTCCTGCTTACTCTACCGGAGGCTTCGTTTTCAACTGTTCCT
TCCTTCTCACCGAAATAAACCAACCCTCCCTTTCCACGAAACACAACCTT
CCTTTAACATCTTAAGTTTGACCATGGCAAGTTCAGATGGCGAACCAGAG
CAGCGCTCAAGAAGAAAGAGTAGAAAACCTGGAAATACCGCTTTCAAACA
ACAGCGTTTGAAAGCCTGGCAACCAATTCTCACACCGCGAACTGTTCTCC
CTCTTCTTTTCGCGCTCGGTATTGTACTTGGACCAATCGGAGGTCTCATG
ATCTTGGGTAGTTCCAAGATACAAGAAATCTCCATCGATTACACCAATTG
CCCAGAAGCGGCCGGCAAGCTCAAAGACATTCCTTCGGAACACGTCCACA
CACACTTCACTTCACCTGTGAATGATCGAGCAATGTGGATGTTTTCGAGT
AACGGTACTGGTGATGATACGCCAAAGACATGCACTCTACATTTCAGCTT
GCCGAATAAACTTGAGCCTCCAGTATTCTTCTACTATCGGCTAACAAATT
TCTACCAAAACCACCGACGCTACGTAAAATCTTTAGACGAAAAGCAATTA
AAGGGTGATGCCCGATCAAAAGGTGCCTTGGGTACCTGTTCGCCGCTTGA
CGCAAATTCCGAAGGGAAACCTTATTACCCATGCGGATTGATTGCAAATT
CCATGTTCAACGACACCTTCGAGCAACCTGTTCTTCTCAACACACAAGAT
GGTAGCGGCAAAGATAACGAAACCTATCACATGACAAACAAGGGCATATC
GTGGAACTCAGATAGAGGGAGGTATGGGGTAACCAAGTATAAACCTGACG
AGGTTGTACCGCCACCAAA

Sequences in the Contig:

SY0AAA8YA23FM1 SY0AAB22YC14FM1 SY0AAC15YN07FM1
SY0AAC21YP21FM1 SY0AAC31YF14FM1 SY0AAD47YF14FM1