Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3758
Length(NT) : 700
Best Gene Model Blast : Link to GSTUMT00011235001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_04637
Accession: ref|XP_001795051.1| Score: 966 E_value: 1e-103
KEGG Definition: mRNA splicing factor RNA helicase (Prp16), putative [EC:3.6.-.-]; K01554
Accession: afm:AFUA_1G03820 Score: 942 E_value: 1e-100
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0924 Score: 905 E_value: 2e-98
PFAM Definition: Helicase_C, Helicase conserved C-terminal domain. The Prosite family is restricted to DEAD/H helicases, whereas this domain family is found in a wide variety of helicases and helicase related proteins. It may be that this is not an autonomously folding unit, but an integral part of the helicase..
Pfam Number: pfam00271 Score: 111 E_value: 3e-06
Swissprot: Q9P774|PRP16_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005524 = Molecular function: ATP binding

Sequence:
>Contig3758
TTGGGTAAGTTTAGCAACTGTATCCTGATATTGTCAGTCTGCTTACGTGG
AGATTATAGATATGACGGATGGTGTCCTCCTCCGTGAGAGCTTAGTTGAC
CCAAATCTAGACAAGTATTCATGCATCATCATGGACGAAGCACACGAGCG
TGCACTAAATACCGATGTGCTCATGGGGTTGATTAAGAAAATACTTGCGC
GTCGTAGGGATTTGAAACTGATTGTTACCTCTGCCACCATGAACGCTGAG
CGGTTCTCTCGGTTTTATGGCGGCGCACCAGAGTATATCATCCCCGGGCG
CACATTTCCCGTGGATGTGCTTTGGTCAAAGTCCCCTTGCGAAGATTATG
TCGACGCCGCTGTCAAACAGGTGTTGCAAATTCATATTGGTCAAGGAGTG
GGCGATATCCTTGTGTTTATGACTGGGCAGGAGGATATCGAGATTACTTG
CGAAGTAATTGCTGAGCGACTCAAACAGCTGAATAACCCTCCAAAATTGA
ATATTCTTCCTATTTATTCACAGATGCCGGCTGATCTACAAGCCAAAATA
TTCGAGCGGGGAGAGGGCGGAGCGAGAAAAGTAATCGTAGCCACCAATAT
CGCCGAGACCAGCTTGACGGTTGAGGGCATTATGTACGTTGTTGATGCCG
GATACTCCAAGCTAAAGGTATATAATCCACGGATGGGTATGGATGCATTA

Sequences in the Contig:

SY0AAB36YD22FM1 SY0AAC15YM19FM1