Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3757
Length(NT) : 250
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 8

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3757
TTGGAGGTAATCTAGTGCCCTTGCCAACGTTCTTTAAAGACCCTCTAATT
TCCTCTTTCCTCGTGAACCTTTTATTTCCCCTTCCCTCTTCATTATTACC
ATCAGGGTTACATGTTGCGCCTGTAAATTTCTCCAATTGCCCACCCTGAT
ACTGAGGGCATATCATACGCCTCCCCCCCCCCCCACCGCTGCCCACTCTT
AACTACTCAAATACCTACTACTTTTTATCTAACAATACCTACCTACACAA

Sequences in the Contig:

SY0AAC15YJ18FM1 SY0AAC15YM17FM1 SY0AAC60YD18FM1
SY0AAD27YD22FM1 SY0AAD43YD03FM1 SY0AAD46YL09FM1
SY0AAD4YM07FM1 SY0AAD58YO20FM1