Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3756
Length(NT) : 1304
Best Gene Model Blast : Link to GSTUMT00012053001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein SNOG_02077
Accession: ref|XP_001792695.1| Score: 1177 E_value: 1e-127
KEGG Definition: hypothetical protein
Accession: mgr:MGG_01769 Score: 1155 E_value: 1e-124
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG2513 Score: 512 E_value: 2e-52
PFAM Definition: No Hit Found
Swissprot: O13621|YNG5_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>Contig3756
TTGGCCGATTTCTACAAAAGACTATTCACAAAATTAAATTTTTTTTTAAA
GAAATAAGGCTGAACAAGAGCAGCCATGGCAGAGCCTAACCCCTCGTCTT
CCCGGGCAGCTGTGGCGAAGAATCAGGGTGTGGACTACGTGATCTCGTTC
CGATTCGGAGGTACAGCCAAGGAGAAAGCTGAAGCTCAGTTTGAAAAGTT
GATTGCTGCCTTGGATTCGGTTGGGCTTAAGACTGAAGCCCGTGACGGTG
CCCATGGATCTGTTCTCGTCTTTGTCACTGCTCGCTCTGAGCAGAAGCTT
ATTGGCGACGTTTACAGGTCTCGAGTAAAGGATTGGCTTTTCGGTGTTCG
CCTTGCAGCACCTGATAAGGAGACTCAAAAATCGTTAGATAAAGAGCCAT
TGACAGAGGCAGAGAGGTTGAGAATTCTGTACAAGTTGATCACGTTGCCA
GTGGATGAAGGTGGTGTTGGGATTACCCCCAAACAGGGTCCCTGGACCCT
AGTGGAGAGTGTTTTCCCGTTGCATGACCCTGATTTCAACAAGATGTGGT
TGAAGGATTGGTCTACCACCTGGATAGTTTCAATAGAGGAGCTGGAGAAA
TTGAAAGATCGGTTTGGTGAGAGGATTGCCTTCTACTTCGCTTTCCTACA
ATCCTATCTCTCTTTCTTGGTTGTTGCAGCCATAATTGGTGTGGGATCCT
ACTCCTTGCTTTCGCAGTATTCGCTTGTCTTCGCTATTTCCAACTGTCTC
TGGTCCGTCATCTTCGTTGAGTACTGGAAGCGCCAGGAGGTCGATTTGGC
CGTCCGGTGGGGCGTCCGCAACGTGTCACAACTACAGAACAAGAGAGCTC
AATTTGTACATGAGAAGGAGGTTGAGGACCCTGTTACTGGAGAGGTGGTC
AAGTTTTTTCCGGCTTGGAAACGCCTATGCCGTCAACTCCTCCAGGTCCC
ATTCGCCTTGGGAGCTAGTGGTATGCTCTCGGCGTTATATGCGACTATTT
TTGTAATTGAGATCTTTATTTCGGAGGTTTATAATGGACCATTCAAGTCT
GTTTTGGTCTTCATTCCTACCGCACTGTTAACTCTATTCGTTCCAATCCT
CATGTCCATCCTCATGAAAGTTGCAGCTGGGCTGACGGAATTTGAGAACT
ATGAGAATGAATCATCCCAGGAAGCAGCAATGACCCAGAAAATCTTTGTT
TTCAATTTTATCTGCTCTTATGTCCCGCTTTTCCTCACTGCATTCATATA
TGTTCCTTTCGGAAATCTGATTATACCCCACTTGGACGTTTTTGGCTTGA
CTGT

Sequences in the Contig:

SY0AAA32YP11FM1 SY0AAA33YB07FM1 SY0AAB2YB01FM1
SY0AAC15YK21FM1 SY0AAC61YI24FM1