Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3754
Length(NT) : 809
Best Gene Model Blast : Link to GSTUMT00006265001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein An11g11120
Accession: ref|XP_001395069.1| Score: 466 E_value: 8e-45
KEGG Definition: hypothetical protein
Accession: ang:An11g11120 Score: 466 E_value: 4e-45
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2210 Score: 146 E_value: 3e-10
PFAM Definition: No Hit Found
Swissprot: O94512|OBP1_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum

Sequence:
>Contig3754
TTGGTGTACTCGTAGTGATGACCCCTCCATATTGTCTCATCCACAGAGTC
ATGTGTACTCGAGTACAAGTACTCGTAACTTACCTATCATCACGTTCAGC
CTTGTCAGAATTCTTCTTTTTTCGGGCAAAATACCGGTAATGGTATGTAG
AGCGATTTCAATCTATGTTGGAGGCATAATTTACATATCACTCGATCTTG
GCAATTAAAGAGGTTCGGGGTTTGGATCCTTTGGAAATATCTATCAGAGC
TCTTAGGCTCTTCCCACCCCCCCAAATCTTCGTCACTCTCTCCGCAGCCC
CGCTCCCTAGATTCCCCCCTTCTTCGCTTGAGAGAAATCATCGTCAAAAA
TCCGCCATGGAAAACACACCTCTTACCCCTTCCTCCTCCGCCCCAACACC
CACTGCAACACCTCCAGGAACCGCCTCGAACACAGGTTCCGAGGCAGAGA
ATCAATCAAAATTAAGGACTCTGCTTGGTATTTTGCGACGTTTCGTCGGA
GTGGCCGACATTGCCTCTGTCCGCTTTTCACTTCCGAGTCAGTTGCTTGA
ACCCGTACCCAACTTAGAATATTGGAATTACTTGGATCGTCCTGAAACTT
TTGCTAGCATTGGCGAATCCGACGATGAACTGGAACGTTTCCTGGGAGTT
TTAAGGTTTTGGTTTACCAAAGATCTGAAATTCGTCAAGGGAAAGCCATG
CAAACCCTATAATTCAACATTAGGGGAATTTTTCAGATGCACTTGGGATG
TCCAGGAGACACTACCACCGGTTCCCTCCCGCCCCTCTTCCCGAAACTCT
CGGAATTCT

Sequences in the Contig:

SY0AAC15YJ08FM1 SY0AAC61YM15FM1