Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3753
Length(NT) : 1330
Best Gene Model Blast : Link to GSTUMT00005273001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: hypothetical protein SS1G_07462
Accession: ref|XP_001592015.1| Score: 460 E_value: 8e-44
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_5G07870 Score: 404 E_value: 1e-37
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3753
TTGGGCACGCAGCACACACACACCAAAGAACGAGAGAGAAAAAGAGACAT
TCTCCGCCGCCAAAAGCGTGACGCGCAACCATTCAGCTTCTACCCTCCCT
TTCTGCCTTCAGTTTCCGCACGCACGCAGCCGAACCAAGGGGGGGAAGAA
AGGAAGGGGGAGAGGGTTTTAAAGAAAGAGAATGACGATGAACACTCAGT
TCATCTCCTCCCATCCTCACCTTCAAAAATGACATCCAGATTCTCAGCTT
CGAGTGCTGCTACTGCGGCAACAGCAGCAGCAGCGCAGAGTCCGCTTGTT
TATCGGTCCACGGCTGAAGGCGGAGGAGTGCTAGGAGGTGGCGGTGGGGG
CGGGAATGGTATGCGCTCTCCACGAAACAACATGAACGGTGGAGCTTCAA
GTGCTGGTACCCCGCGAAAGTGGCCTGCAGGCTCCCCACCGATGAATGCA
CCGCCAGAGTCACCGTTGCAGAGTACAAGTCGGAGGAATTCGCTGCTGCC
AGAGAATCTCCAGGACGCTACAAAAGTGCTCGTTCCATTACCGACGGACG
CGGACTCATCGCCCTGGCATAACGTCCCGCTCGCGTTTGCACTCTTACCT
GCCCTTGGAGGTATACTCTTTACTGATGGAAGTTACTTTTTCACGGATGT
TATTCTTATCTTCCTGGTGGCGGTGTTTTTGCATTGGCTGGTTAAATTTC
CGTGGGAGTGGTATGGCAGCTCTCAAGCCTTACGGTACGAGCGAGATGCG
TTTGAAGCCCTGGCGACGCCGGTGGAGTTCTTGAAGGATGGCGATGCACC
GGATGCGACGCGGTCCGCACATGAAGAAAGGTTGAGGGCGGCTGCTGCTA
GGGAATTGCGGATGAACGAGGTGTTAGCTCTTCTGGCTTGCTTTGTCGGT
CCATGTGTAGGGGGTTCGTTACTGCATGCTATCAGGTCGCAGTTGTCTAG
GCCTAGCGAGGGGCTTGTGTCAAATTTCAATCTCACGATATTTGTTCTTG
CAGCGGAGCTCAGGCCTGCGGCTCAAGTGGTCAAGTTGATTCGGAATAGG
AGTTTATATCTTCATTCGGTTGTGCATCACCCACCGATGACTAGGATAGA
TGCTTTGACAGCGAGGTTGGAAGAACTGAGTGCTGAAGTTCGAGATCTCA
CATTGATGACGACCAAGGCTGTAGATAGAGGTTCTCATTTGGATGCTTTG
ACGAGAGCGGTGCGCCGTTACGAAAAACGAGAGACGGTTCACTCTGCCCA
AACGGAGAATCGAATCCTTGAGATAGACAACCGTCTAAACGATGTTCTTA
CCCTTACTGCTGCTGCTTCTGCTAGGCAAA

Sequences in the Contig:

SY0AAA39YD12FM1 SY0AAA50YN03FM1 SY0AAB1YM24FM1
SY0AAB37YI19FM1 SY0AAC14YH20FM1 SY0AAC15YJ01FM1
SY0AAC44YI13FM1 SY0AAD21YI04FM1 SY0AAD29YA05FM1
SY0AAD58YM23FM1 SY0AAD9YL10FM1