Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3752
Length(NT) : 1427
Best Gene Model Blast : Link to GSTUMT00006942001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_503593.1| Score: 580 E_value: 1e-79
KEGG Definition: hypothetical protein
Accession: yli:YALI0E05621g Score: 580 E_value: 6e-80
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG1843 Score: 519 E_value: 3e-53
PFAM Definition: DUF500, Family of unknown function (DUF500). Proteins in this family often also contain an SH3 domain (pfam00018), or a FYVE zinc finger (pfam01363)..
Pfam Number: pfam04366 Score: 241 E_value: 5e-21
Swissprot: P32793|YSC84_YEAST
Gene Ontology:
GO:0030479 = Cellular component: actin cortical patch
GO:0005515 = Molecular function: protein binding
GO:0007015 = Biological process: actin filament organization
GO:0006897 = Biological process: endocytosis

Sequence:
>Contig3752
TTGGGGTTACTCTGTGCGAGCAAATGGATAGGGCGGAGGGAGGCGGAGCA
AGTTGATTGTGCTACAGTACGAGTACGAGTACTCGTACAGTAAGGCCAAG
ACTCTATCATCAGTGGGAGAGAGCAAAGTTACATCATGCGTGGGAGTGCT
CGAGCATCCAGAGGGGGTAATTTAACTAGGTCAAGTTCTGCTCTTTTGTC
CACACTCTTACTCGAGTACTGTACACTGTTTCTCTTTCTTCTCATACTTG
AGTACACACCCACACCCACACCCACACACTCTTCCTCTCCCTCTTCCCTC
TCTCCCTCTTCCCTTTTCCTTCCCCCGATTATTGGGCCGGTATATCGCAG
TTTCACCTGGTGCGGTTGATTTTGTACTTTTCGCCAACTGATTAGCTTCA
CGTGAGGGCGTCGTCGTCATCCTTTTTTGGTCATCCTTTTTTGGCCCTCC
TTCCCTCCTCCTATTCTTCCTCCTGCTACGGTGCTCTTATCGTACGAGCC
GAGAGTGTTTGTTTGAAAAGCTATGGGAATCAACAACCCTCTCCCAGCAA
GTCTACGCAGCGAGTGTCGTAAAGCCTCCAGGATCTTGGCTTCGTTTGTT
GATCCCAAACAGAGCTTTGGGCCTGATAAGATTATCCCGCCTTCTGTTCT
TTCTAATGCTAAGGGGTTGGCGATTATCACGGTGCTTAAAGCGGGTTTCT
TATTCTCGGGGAGAGTCGGATCCGGATTGGTGGTTGCGAGAAAGGGTGAT
GGGTCTTGGTCTGCTCCGTCCGCAATCGCTACGGCTGGCGCCGGGTTTGG
AGGCCAAATTGGTGCTGAATTGACCGACTTTGTCATGATCCTAAATGACT
CGAACGCTGTCAAGACTTTCGCTCAGGTTGGTAGCATCACGCTTGGAGGA
AACGTATCCGTAGCTGCAGGTCCCGTAGGAAGAAATGCGGAAGCTAGCGG
TGCAGCAAGTTTAAGATCTATAGCCGGGATCTTTTCCTATAGGTGCTCTA
ATTTTCCCACTCGCCAAGAATCCTTGGCATTGTCGTACAGTCGCTGATCT
CGAGTAGTAAAACCAAGGGCCTTTTCGCCGGCGTCTCGTTAGAGGGTTCA
GTGATTGTGGAACGAAAGGATGCCAACAAGAAGTTTTATGGGGGGAACGT
CTCTGCTAAGCAGCTGCTCAGCGGCAGCATTGGCCCACCACATGACGCGG
ACGCACTCATTCGGATTCTGAACTCCCGTGTATTCTCTGGAAACCTTACT
GGTCAACTATGACGATATGTATAATGATATTCCTACCTACGACAGTGATA
AAGACGAGTCTATTTGGGAGGGTCAGAGCGGCAATGCTTATGGTGAAGGG
ACGAGACGGGGCTCAATAGGGAATCGCAACTTGTCCAGGTCTTCTACTTG
GAAGGACGATCGGGATAGTGGTTCTCC

Sequences in the Contig:

SY0AAA36YD01FM1 SY0AAA60YE19FM1 SY0AAA8YL12FM1
SY0AAB33YA20FM1 SY0AAB41YJ01FM1 SY0AAB47YI14FM1
SY0AAC15YI09FM1 SY0AAC16YI09FM1 SY0AAD47YK19FM1
SY0AAD6YE18FM1