Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3751
Length(NT) : 829
Best Gene Model Blast : Link to GSTUMT00001317001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein BC1G_11779
Accession: ref|XP_001550021.1| Score: 251 E_value: 7e-20
KEGG Definition: hypothetical protein
Accession: mgr:MGG_06331 Score: 224 E_value: 5e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3751
TTGGGCATTGTATGATAAAACACGATCTCTGAAATTCCACAACCCCTCGG
TAACAACCCTCCCTCAACAACGTGCCTACGCCCCTCCAGAGCCGCCGCAT
ACTTGTACAGTAACTCTTCACGCCGCAAGAAACACCGTCCGGGACAATAC
TGTAATCCAAGCGAGATCCGCCTTAATTGCGGGTCATTCCCACATCCCCC
ACCCAATTCCCACCTCGCCCTCACCTCCACCCTACCGCAATAACACCACT
CGCTTTCTCTTCAGTTCACCAACAACGCGAGCTGCAATACCATCATGGCA
TCTCCATCCGAAGCATCACCACCAGCAATAGCTGCCGCCACCGATCCCCT
TCCCGAAGTACTGCCAATAAGACGAACACGGACAGCCTCCATTACGCAAT
CAATACTGGACGCGAATCCCCATTACGGTGTATTAGCTGCAGCCGGTGAA
GCTCTTGCCCGTGCTCCATCTCTGAAAGACTTGCGGCGAAGTTCTGTTGG
TAGTGGAAATAGCCGGGGTCGGAGGGGAAGTGCTATTTCTAGTGCGGCGA
CTCCACGGGCCGAAACAGGATTGAGAGCTGCCGCGATTGACGAGGAGGAA
GCTGGCAGAAGGAGTCGGGAAATTCCCCCAGTCAGGGGCATGATAGACGG
CAATGTGCGTACCCGACTGCAACGATATCGATTCCCCCCGACGCATATGG
ATTGAAATCGATTCACAGATTCTCAATGCGCTCTTCTGCGTAACGGGTTT
CGGCCTCGTACCTTGGCGGTTCAGAGATCTATATTTTCTTCTCAGGTGGC
GCCTCTTTTCTGATAAGCGAGCCCTGCAC

Sequences in the Contig:

SY0AAA59YL10FM1 SY0AAC15YI06FM1 SY0AAC29YG20FM1
SY0AAC32YP13FM1 SY0AAD22YM05FM1