Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3750
Length(NT) : 2137
Best Gene Model Blast : Link to GSTUMT00012200001 E-value : 0.0
Numbers of ESTs : 30

Blast Results:

Nr Definition: malate synthase
Accession: gb|ABP96876.1| Score: 2718 E_value: 0.0
KEGG Definition: malate synthase AcuE [EC:2.3.3.9]; K01638 malate synthase
Accession: afm:AFUA_6G03540 Score: 2283 E_value: 0.0
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1261 Score: 1915 E_value: 0.0
PFAM Definition: Malate_synthase, Malate synthase..
Pfam Number: pfam01274 Score: 2063 E_value: 0.0
Swissprot: P28345|MASY_NEUCR

Sequence:
>Contig3750
TTGGCTATCACAAGCTTCCCCTATCCTCCCATCCGACTGCTCTTTTCTCC
CCCCACCTCGTGACGTGCTCTATAATTCCTTCGATGGGTGGAGCAGTTGT
TTTAGTTTCGTAAACCTTCCTCACAAAAATCACAACAAGCCTACCTTACA
CAAACATAGGAGCAAGCATGGCTGACACCGAAGACCTCATCAAGGACACT
CAAATTCTTGGCCATGTGCAAGACCCTCACCGCAAGATCCTTACGAAAGA
ATGCTGTGCATTCCTAGCTACCCTTCATAGAACGTTCAATGCTACCCGGA
AGCAGCTCCTCCACAGACGTGTGCTCCGTCAAGCCGAGATTGACAAGGGT
GTCCTCCCCGACTTCCTGCCGGAGACCAAGCACATTCGTGACAATGATAC
ATGGCGTGGAGCTGATCCTGCGCCCGGCCTGGTGGATCGCAGGGTGGAGA
TTACCGGGCCCATTGATAGGAAGATGGTTGTTAATGCTTTGAATGCCGAT
GTTTGGACTTATATGGCGGATTTTGAAGACTCTAACTCGCCAACCTGGGA
TAACGTGATTAACGGGCAAATCAACTTGTACGACGCTATCCGCCGGCAGG
TTGACTTTAAGCTCAACGGGAAGGATTACAAGCTCCGCACTGACCGTCCT
TTGCCAACCCTGATTATTCGTCCTCGTGGCTGGCATCTTGACGAGAAGCA
CTTTGTCGTCGATGGCGAGCCAATCTCTGGCGCTCTCTTCGACTTTGGGT
GTTACTTTTTTCACAATGCTAAGCAGTTGATCCAGAACGGCCACGGGCCG
TACTTCTACCTGCCAAAGATGGAATCGCATCTGGAGGCCAAATTATGGAA
CGATGTATTCAATCTTTCTCAGGATACCGTTGGAATCCCAAGGGGCACCA
TTCGTGCTACGGTATTGATCGAGACTATCCTGGCTGTTTTCGAGATGGAC
GAGATCATCTATGAATTGCGGCAGCACAGCTCCGGTCTCAACTGCGGTCG
TTGGGATTACATCTTTAGCGTGATCAAGAAGTTCAGGAATAACCCACAAT
TCGTGCTCCCGGACAGAAGCGCTGTTACCATGACTGTGCCATTTATGGAG
GCGTATGTCAAGTTGTTGATTAAGACATGTCACCGCAGAGGTGTTCATGC
TATGGGAGGAATGGCTGCACAGATTCCTATCAAGGATAATGAAGAGGCCA
ATAAGAAGGCTATGGCTGGTGTCTATGCCGATAAGCTACGAGAGGTCAGG
GCCGGTCATGATGGAACTTGGGTCGCTCACCCCGCCCTCGCAAAGATCGC
ATCTGAAGTCTTCAATAAGCACATGCCAACCCCCAACCAAATTTTCAAGC
GCAGGGAGGAAGTCTCTGTAACAGCAATGGACCTTCTCAACATGAACATG
CCAGGCGCAGTCACAGAGGAGGGAATCCGCAAGAACCTAGAAATCGGCAT
CGGATATATGGAAGGCTGGCTTCGCGCCGTCGGTTGTGTGCCAATAAACT
ACCTAATGGAGGACGCCGCCACCGCCGAAGTCTCCCGTTCTCAACTCTGG
CAGTGGGCCAAACACGGTGTGAGCACCATCGAAGGCAAGAGGGTCACCAA
AGAACTGAACCTCCAGCTCCTCAAGGAGACCACAGAAAAACTCGCCAGCA
AAGCGCCCGCTGGGAACAAGTACCACCTTGCGGCACGCTACTTTGCGACC
CAGATCACCGGGGAGGACTATGCGGATTTCCTTACTACTCTGCTGTATAA
CGAGATTGTAACGGTGGGTGGTGCCGCAAAACTCTGATTGCCCTCCTTCC
TCCTCCTCTTGTTTCTTTTAGGGTTAGGGAATGTTTGCAGGATTGATTGG
GTGGGGGTTTGTACGATCTGAGAAAAACAGGGGTATGGCAAGTCAGGGAG
AATTATTTTGGTGCCAGATTGGGGCTGTAGTTTCGCTCGCGTTGGGCGGA
TCATTTTTATTCTTCTTTTCTTCCGGGGTCTGATTTTTAGCAGGCTGGGG
GTTCTTCTAGGGTGGATGGGGATGGGGGGTTTAACGCAATTGGGTTTGTT
GGCTTGGGAAAAAAACTGAAGAAGGGTAGTACTTGGGTTGGGCTTCAGTG
CCGCAATACTACGGACAAACAAATTACTACTTTTTTC

Sequences in the Contig:

SY0AAC15YH12FM1 SY0AAC17YB16FM1 SY0AAC17YB16RM1
SY0AAC20YD12FM1 SY0AAC24YP11FM1 SY0AAC29YO05FM1
SY0AAC30YE08FM1 SY0AAC34YD05FM1 SY0AAC45YH15FM1
SY0AAC47YE09FM1 SY0AAC49YL21FM1 SY0AAC4YG07FM1
SY0AAC51YE03FM1 SY0AAC53YF10FM1 SY0AAC56YB20FM1
SY0AAC56YI15FM1 SY0AAC7YI19FM1 SY0AAC9YB11FM1
SY0AAD14YD15FM1 SY0AAD31YK06FM1 SY0AAD33YD06FM1
SY0AAD42YL17FM1 SY0AAD42YL19FM1 SY0AAD44YA02FM1
SY0AAD49YO16FM1 SY0AAD55YG17FM1 SY0AAD56YB21FM1
SY0AAD58YB08FM1 SY0AAD63YN22FM1 SY0AAD6YI24FM1