Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig375
Length(NT) : 751
Best Gene Model Blast : Link to GSTUMT00003047001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig375
TTGGCCCACATCTTGATCCTCCACTTATCTTTCTTATCCAAACATCACCT
CTGATTGAGAACTTTCAAACCCTCAAGATGCTTATTCTCCGTGCTGCATT
CAAGTCAAGCCATTTCCCGCTTCTTGTTAGGCCAGGCGTGAATAGTTTGG
CGGGCAGGAATAAGCCTATCGGTGGGGTCTCCCCATTCACTTTCTCGGCC
TTTGCTTGCCGACCTCACACCCAGGAAGTGCCGTCGTTTCCAAAATTTCA
TGAATATTCAACAAAACCGGATATGCCTATTCGAGTGCCTCTAACCCCAG
ATAACGAAACTGCACGCTTCCATCGTCATGAATATGTCCCTGAAGTCCAG
CCTCCGCACAAGCCCGTGATTTTCACAATCAATGAAGATCCCGCCGTCGT
TTCTTCGGAGGGCAGTGCTATCTTGGGCAATGCTGACGCGGAGGTTTACA
TCAAGCAGATGAACCCTGATGTTCCGGATATGCCCAAGAGTGAGAAGGTG
GAGTTTTAGTGTCTTTTTTTCCTTCCTTTTCTTTTTGGTTTTGAGGCGTT
CTGTTTATTCATTTCTACTATGACCGTAATCAGGAAAAAAGGTTAAAAGG
ATCAAAGGTTGGGAAAAAACAAGCAAATGGGGAGGTTCAACTTATGATTT
ACGATTATGTTGCCAATGATTTTAGCTGCGGTATTAGTTATTGATTATGT
TGGACACTTTATGGTGGCTACTCGAGTATATGTGTAAGGTTGATCTTATA
T

Sequences in the Contig:

SY0AAA22YE15FM1 SY0AAA25YK11FM1 SY0AAA31YC15FM1
SY0AAA7YA10FM1 SY0AAB22YE12FM1 SY0AAB2YP07FM1
SY0AAB39YL12FM1 SY0AAB40YL11FM1 SY0AAB49YF14FM1
SY0AAC62YE10FM1