Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3749
Length(NT) : 665
Best Gene Model Blast : Link to GSTUMT00003438001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: 2-hydroxyphytanoyl-CoA lyase
Accession: ref|XP_747326.1| Score: 508 E_value: 7e-50
KEGG Definition: 2-hydroxyphytanoyl-CoA lyase, putative [EC:4.1.-.-]; K01671
Accession: afm:AFUA_8G05230 Score: 508 E_value: 3e-50
KOG Definition:
Classification: [Amino acid transport and metabolism, Coenzyme transport and metabolism].
Kog Number: KOG1185 Score: 403 E_value: 3e-40
PFAM Definition: TPP_enzyme_C, Thiamine pyrophosphate enzyme, C-terminal TPP binding domain..
Pfam Number: pfam02775 Score: 210 E_value: 7e-18
Swissprot: Q9Y7M1|YGK4_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig3749
TTGGGGGGACAACTTTGTACAAAAAAGTTGGAAAAACCTAGCCATAGCCC
GGGTGAAAGCCTCGACCCCAACAAACCCACTAACATACCATCGCACCTTC
GCCCTCATCAAGTCAACCCTGGAATCATTATCCCCGGGCGGCGCCGAGAA
CCTAGTCTACGTCTCTGAAGGCGCCAACACAATGGACATCTCCCGCAGCA
TCTTTACCGTGTCACAACCCCGCCAGCGCCTGGACGCAGGCACCTACGCA
ACAATGGGCGTAGGCCTTGGATACGCCATAGCCGCTGAAATGGCCTATAA
CTACACCCACGAAGCCGTTCCCTCCACCCCATCTATCAGAAAAAGGATTA
TATCCCTAGAAGGCGACAGCGCCCTCGGTTTCTCCCTCCCGGAAATCGAA
ACCATGTCCCGCTACCGCCTCCCCATCATCATTTTCGTCATGAATAACGG
GGGCGTGTACCACGGCATATCCGACAACACGCCCACGTGGGGTGCGGACT
GGTGGGACGGGGATAAGGAGGGGAAGAGGCGAGATGTTCTCCTCACGAGT
ACCGCGCTGGGTTTCGAGACTGGGTATGATGTTGTTGCTAGGGGGCTGGG
TGGCAGGGGGTGGAGGGTTGTGGATGAGGAAGGATTGGTCGAGGCTGTGC
GGGAGGCGTGGGATC

Sequences in the Contig:

SY0AAB59YB18FM1 SY0AAC15YG16FM1