Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3748
Length(NT) : 678
Best Gene Model Blast : Link to GSTUMT00003945001 E-value : 2e-22
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG04396.1
Accession: ref|XP_384572.1| Score: 233 E_value: 6e-18
KEGG Definition: hypothetical protein
Accession: fgr:FG04396.1 Score: 233 E_value: 3e-18
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG1701 Score: 119 E_value: 3e-07
PFAM Definition: No Hit Found

Sequence:
>Contig3748
TTGGCACTCCTCCAAAACCCCCACAAACTCCACCCCCTTCCCCGCGTCCA
GCAACTCCCCGCTCCCAAGCACCGTCCGGACAAACACCCAAATGCTCTCG
TGGCCCCGCGCAATCCCGTGCGCGAACTGCATGCTCTTTTCCACAATATC
CGCCAATTGTGCCCGGAACGAGTACGGGTTTGGGTGCTCTAGTGTCTGAA
AGAACAAGAACTGCAGGAACGACCACACGCTGGTGTCCGACACGTGGCAG
AGGGCAAAGTTCGCCGTACGCTCGAGGACGTATGGGAGCTGAGGGCCGGA
TGGGGAACGCGGGAGGAAGAATTTGGTGGCGAAGCGGGCGTGGTTCCAGG
CCTTCTCCATCGCTCAGTCATAGCTGTAGAATGAGATGAAGGAGGGGGAG
GAAGGGGGGTCTCCTACGTAGTAATTCCTAGGGTGCACCTCCGCACTAGC
TTCCACAACCGCCAATTCCGCCTCGATCCCTTCTTCCAAAACCCCGAACC
TCTCGGTCAACCACCGCCTGTAACTCCATAGCAACGGGCTCTTGTTGTGT
TTGTTCAACGGGGACGTCAGGAAGCTCTCTATTAGTCTGATTTCGTCCCG
ACCGCTATTGGCGCCTTTGCCCAGGATGATCCTCCTACGGGCGTTGACTG
CAGAAAGGTTTTCCGATGCGACGAGCAG

Sequences in the Contig:

SY0AAC15YF16FM1 SY0AAD46YH24FM1