Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3747
Length(NT) : 1907
Best Gene Model Blast : Link to GSTUMT00001493001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SS1G_08935
Accession: ref|XP_001590171.1| Score: 512 E_value: 1e-49
KEGG Definition: sensor histidine kinase/response regulator, putative
Accession: afm:AFUA_4G07400 Score: 437 E_value: 3e-41
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0090 Score: 303 E_value: 5e-28
PFAM Definition: SRPRB, Signal recognition particle receptor beta subunit. The beta subunit of the signal recognition particle receptor (SRP) is a transmembrane GTPase which anchors the alpha subunit to the endoplasmic reticulum membrane..
Pfam Number: pfam09439 Score: 290 E_value: 2e-26
Swissprot: P36057|SRPB_YEAST
Gene Ontology:
GO:0030176 = Cellular component: integral to endoplasmic reticulum membrane
GO:0005785 = Cellular component: signal recognition particle receptor complex
GO:0005525 = Molecular function: GTP binding
GO:0005515 = Molecular function: protein binding
GO:0005047 = Molecular function: signal recognition particle binding
GO:0006614 = Biological process: SRP-dependent cotranslational protein targeting to membrane

Sequence:
>Contig3747
ATGGAAAATAACACCTGGGGAGAAACGGGGTTCAGAACCTCCACGGCGAC
AGAAATGCTTCCATTCCCGGTAAACTTCACAGCATTGTGGAACACACTCG
ACAGTAGTTTCGTCAGGGCATTCCCGTCAACAACAAGCGTTTCCGGAACA
CTCTCATCCACCCTCAACTCAATCTCAACAGTACTATTCATCTCCCCAGG
GCCTATGGTCGAAACAATAATCCTCTCCCCCTCCGGCGTCTCCGAAGACC
GTGTGGAATCAGGTCGCCCACCAGACCTCAGCGTGTCGTGGAGAATCTGA
CGCAGCAACTCCCGAATCTTTAAGGGGCGAGAATTTAGCTGTATTTTCCC
GGCCGCGTCAAAGAACAGGCAAGCACCAGACGGCGATGGGGAAGCAGCTG
ACAGCAAGCTGTGGCCCGAGCTGCCCCGCCGTTGTATGTCATCGGGCATC
AGCAGGGGTGCAGGGGACCCAGTGTAGCTGGGTGGTGAGAGACTCCTCGA
CCGCGATAATAATAATGGCGGGCCAAGTATCTCGTCGCCATCCCCATCGT
GGTCTAGGCCCTGGCTGCGGTGCCGCACCTTGTGCGGCATCATGTCCTCC
GGTGACCAAGATTCTCGCCGCCGTTTGCTCGACTGTCGTGGCATCACTCT
TGGCGTTGACAGGTCAAAGTCGTTGTCCTGCATTGGCGTCAAGGTGGAAT
CCGACTCGTCGGGTAAATCTAGAAGCACCTGGCTAGCCATCTTTGGTGTC
GAGGGAACCTCCATGTCGAGATCGTAAGCGTGAACCATGTTATCGGCGGC
GTCAACAGCCCGTTTTGAACTGTCTTGAGCAACCTCTATGCTCTCCCTAA
GAGACTCTACCATGTTCCGGATCTGCCCCATATCGCCTGCCTCCCATTCC
GTAGCCTCTAACACCGAAGCATACATAACATCCAACATCCCAACAACGCC
CTGCATAGGTGTCCGCAATTCGTGCGATAAGCTTCGTGCATAGGGCTTTA
ATGACTGCCGTGAAGTAACGGCCTCATTAGGAATAACCTCGTTCTCCATC
TTAGGTCCAAACCCTTCTCCTTCCAGTATCCGGCCAACTTTTTTGTACAA
AGTTGTCCCCCCAACTTTTTTGTACAAAGTTGTCCCCCGAGGATCTATAT
TCGCTCCCTCGCCGACAGTCCTGATAACTACTATACTGGTTATCTTCCTC
ACACCTATCTTCCTTCACTTTATTGTGTTCCACTCTCGTTCTCCGATTAG
CCTTCCAACATTCTTGTTAGTTGGGCCTGCAGCGAGCGGGAAAACCTCTC
TTATGACATCGTTTGAATCTGAGCCTGGTCAACCTCCCGTCGAAACACGC
ACAAGTCAAACACCACATTCCCTAGAATGCTTTGTTCCTGCCTCCATCGC
TAGGACATCGGAGTACAGATCTGCCCATGACCCTTCTCTCAAAGCGCATA
AAAGATTCCTTCTTCTCGACACACCTGGGCATGGCAAGCTGCGTCATATA
GCTCTTACTCGGATTTCCTCCACAACAATTCGTGGAGTTATTTTCGTCCT
CGATTCCTCTCTCACCGATGTTCGGGTAGTAGCTGAATATCTCTATGATG
TTCTATTGACTTTACAAAGTTCTGCCACTTCAACCACTACACAGTCCAAA
AAATTACTAGTCGCTTGTAACAAAAGCGATGCTTTTACAGCACTACCTCC
ATCTAAAATCCAGAAACTTCTGGAAGATGAAATCACAAAAATGAGAGTTT
CAAGGTCCAAAGGAATCCTGGACGTTGAGGATGACGGTGAGGGCAATGAT
GAGAAGGAGTGGTTGGGGGAAGGCGGTGAAGGTCCATTTACTTTTCAGAG
CATGGAAGAAGTTGGTGTGGAGATTGAGTTCAAAGGAGGTAGTGTGGAGA
ATGGAGA

Sequences in the Contig:

SY0AAB14YC10FM1 SY0AAB51YC24FM1 SY0AAB57YO03FM1
SY0AAC15YF10FM1 SY0AAC26YM02FM1 SY0AAD19YB13FM1
SY0AAD44YJ01FM1