Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3745
Length(NT) : 962
Best Gene Model Blast : Link to GSTUMT00008726001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: peroxisomal membrane protein (Pex13)
Accession: ref|XP_747320.1| Score: 409 E_value: 4e-38
KEGG Definition: peroxisomal membrane protein (Pex13), putative
Accession: afm:AFUA_8G05160 Score: 409 E_value: 2e-38
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG3875 Score: 390 E_value: 2e-38
PFAM Definition: Peroxin-13_N, Peroxin 13, N-terminal. Both termini of the Peroxin-13 are oriented to the cytosol. Peroxin-13 is required for peroxisomal association of peroxin-14..
Pfam Number: pfam04088 Score: 294 E_value: 2e-27
Swissprot: P80667|PEX13_YEAST
Gene Ontology:
GO:0005778 = Cellular component: peroxisomal membrane
GO:0030674 = Molecular function: protein binding, bridging
GO:0016560 = Biological process: protein import into peroxisome matrix, docking

Sequence:
>Contig3745
TTGGCTCATTGGATAGTCTGTTCTTCATACTTTCTTCTATCGCTCCTTCC
CTATCGGATTTATATATATATATCCCTTTTATTCATCCTACGAGTCCCGT
TGCTCGGTTATTGCAGGCAGAAATTGAGAGTGGAGCGACGTGGTGGTAAT
CCAGTGACCTTGCACACCAATCCTTGGCTACCCATCGCCAACCTCCCGTT
GGGTTCTATTCGCCCCTGCTTCACCACCACCAGACCATGTCCCAGATTTC
TCCTCCCAAGCCGTGGGAAGTTAACGGTCTGCAACAGTCTTCTCTCGGAT
CATCATCATTGAGTATAATGTCTACTACAGCAGCGGCCCCTGTCCCCCCG
CCAGCTCCAGCGACTACTGCAGCGCCTGCGATGGCGGCGCCAGGGGCTAC
ACTCTCCGCACCACCCTCACTCCCTGCTCGACCATCAGCTCTTACTGGTG
CCATGACTGCGAACCGACTGGGAGCAACAACAACCGCTGCAGGAGCTTAC
TCCGCCTACAATAGACCAGGTTATGGTCTCGGCGGCGGCCTCGGGGGTGG
ATACGGCTCTTATGGAGCTGGAATGTCACCGTACTCGCGATTCGGTGGAT
ACGGTGGGGGTATGTACGGGGGGATGGGTGGTTTCGGGGGATACGGAGGC
TTTGGAGGGATGCCTGGCGATCCGAATGACCCGAATAGCTTTGCACGTGG
GATGGAAAGCAGTACTGCTGCTACATTTCAAATGATTGAGAGTATCGTCG
GAGCGTTTGGAGGTTTCGCGCAGATGCTCGAGTCGACGTATATGGCCACT
CATTCCTCATTCTTTGCAATGGTCCAGGTCGCCGAGCAATTTGGCAACCT
TCGGAACACTCTCGGGTCAATCTTAGGTATTTTTACAATGATGCGATGGG
CACGCATTGCCGTGGCAAAGGTGACCGGCCGTCCACTGCCAGCGTCAGCC
GGCGAGTTGACT

Sequences in the Contig:

SY0AAA23YE03FM1 SY0AAA53YG17FM1 SY0AAB35YK04FM1
SY0AAB43YI18FM1 SY0AAB47YI16FM1 SY0AAC15YF01FM1
SY0AAC31YI18FM1 SY0AAD17YA22FM1 SY0AAD30YL23FM1
SY0AAD40YI20FM1 SY0AAD43YA15FM1 SY0AAD44YE17FM1