Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3744
Length(NT) : 983
Best Gene Model Blast : Link to GSTUMT00011072001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein SNOG_10773
Accession: ref|XP_001801033.1| Score: 462 E_value: 3e-44
KEGG Definition: hypothetical protein [EC:2.7.1.78]; K08073 polynucleotide 5'-hydroxyl-kinase
Accession: spo:SPAC30.02c Score: 407 E_value: 4e-38
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3062 Score: 457 E_value: 3e-46
PFAM Definition: KTI12, Chromatin associated protein KTI12. This is a family of chromatin associated proteins which interact with the Elongator complex, a component of the elongating form of RNA polymerase II. The Elongator complex has histone acetyltransferase activity..
Pfam Number: pfam08433 Score: 509 E_value: 3e-52
Swissprot: P34253|KTI12_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0003682 = Molecular function: chromatin binding
GO:0016049 = Biological process: cell growth
GO:0006357 = Biological process: regulation of transcription from RNA polymerase II promoter
GO:0006400 = Biological process: tRNA modification

Sequence:
>Contig3744
TTGGCCCATTTCCATCAAGCGAAGGGTAAATTGTTGGAATAAGCTCGGGT
GTGCACAAGAGGAACGGTAGTATTTTGCAGTTTCAACCCAAAAACTTCGA
GATACCAAAAGAAAAGATCAAATGGCTAAACGCATATAGAGAATATCGGT
GATCTCATCCTTCATGAGAAGAAACCTGCTTCCTGTGTTCAGTCCGTAAC
GCATCATCGTTCTCATGCCAATATACACCTCTAGACGTAAATCATGAGGA
TATAGTGTCTGGCTTTTACGATATTGGAGCCGTATAATCGAGGACCCAAC
CAAAACCGCCTAACCGCCTAAACGGATGCAACCTAGTGGAAAGGAACGAT
ATGGGAAGGCAAGTATTCGAGTGACTCATTGTGAGCGAGTGATTTCGGAG
AAATTAGGGATCCCCTATACCGAAACTCAATTTAACACGACAGCCACAGG
AATTCTAAACTAAAGTCTTCATTCACCATGCCACTAATAATCATAACCGG
CTACCCCTCCTCCGGCAAAACTACCCGCGCAACACACCTCCACACCTACC
TGCAAGCCAAACTCGACTCACCCGACACCCCGCCCCAGCAAAGGAGCCAA
AAACTGCACCTGATATCCCCGCACACGCTGCAGATCTCGCGAACGAGCTA
TAGTACCGCCGCCAGCGAAAAGACCGCCCGCGCGACTGAGTACTCCGCCA
TCAAGCGTGCCCTTTCGAAGGACGATGTCGTGATCGCCGATGGGCTGAAC
TACATCAAGGGCTACAGGTACCAACTGTTCTGCGAGGCGAAAGCGCTGCT
GACGCCGAGCTGTGTCGTGCATGTGGCGGCGCCGGCGGAGAAGTGTCGGG
AGTGGAACGCGGCGAGGGCTGAGGCGGCGGAGCGGTGGGATGGGGACACG
CTGGAGAATCTGGTGTTTAGGTATGAGGAGCCGAACGGTATGGTGAGGTG
GGATTCTCCACTTTTTACTGTGCCCTGGGTGGA

Sequences in the Contig:

SY0AAA62YH04FM1 SY0AAC15YD15FM1 SY0AAD35YB20FM1