Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3743
Length(NT) : 754
Best Gene Model Blast : Link to GSTUMT00008607001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001225446.1| Score: 728 E_value: 4e-81
KEGG Definition: hypothetical protein
Accession: ang:An17g02330 Score: 705 E_value: 2e-78
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0068 Score: 440 E_value: 2e-44
PFAM Definition: 2-Hacid_dh, D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain. This family represents the largest portion of the catalytic domain of 2-hydroxyacid dehydrogenases as the NAD binding domain is inserted within the structural domain..
Pfam Number: pfam00389 Score: 360 E_value: 3e-35
Swissprot: P40054|SERA_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0042802 = Molecular function: identical protein binding
GO:0004617 = Molecular function: phosphoglycerate dehydrogenase activity
GO:0009070 = Biological process: serine family amino acid biosynthetic process

Sequence:
>Contig3743
TTGGCACCACGAAAACTGCCGAAATTGTGAGAACATGACAGACCCACAGC
AAATCGAAGTGAATGGGCTTGCTCATGCCATATCTCACACACTTAGCCTG
TCCAATTCGCCCACCTCCGTTTTCCACTCTCCGGTGGGCTCGTACAGCTC
TAGGACTACGCTCAACCGACCTTCGGGAAAACAATTGAAACCGTTTAACA
CGCAGGATATTAAAATTGTGCTCTTCGAAAACGTTAACATCGCGGCAAGA
GAAATTTTAGAGTCTCAAGGCTACCAGGTTGAATTTCACAAGTCTTCCTT
ACCAGAAGACCAGCTTATTGAAAAAATTCGGGATGTTCATGTTATTGGAA
TCCGCTCAAAGACAAAGCTCTCTGCGAAGGTGTTGCGTGAGGCGAAGAAT
CTGCTTGTGATTGGGTGCTTTTGCATTGGTACTAATCAGGTGGATCTCGA
GTATGCTGCCAAGCACGGTATCTCGGTCTTCAACTCCCCGTTCAGTAATT
CCAGAAGTGTTGCCGAGCTTGTCATCTCTGAGATTATCGCTCTGGCGAGA
CAGCTCGGCGACCGTTCGATGGAGATGCATAATGGCACCTGGAACAAAAT
CAGTACCAAGTGTTGGGAGATCCGTGGAAAGACCTTGGGCAAGTTTTCAT
TCTGGAAATACTCTGTTAGGAGCGGGCGCTGATAGGTCTTTTAGGGATCG
TTGGGTATGGTCATATTGGATCGCAACTATCAGTTTTGGGCGAGGCTATG
GGAA

Sequences in the Contig:

SY0AAC15YC15FM1 SY0AAC27YG22FM1 SY0AAC36YP07FM1
SY0AAC59YP08FM1