Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3742
Length(NT) : 1054
Best Gene Model Blast : Link to GSTUMT00003922001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein BC1G_07031
Accession: ref|XP_001554443.1| Score: 670 E_value: 3e-68
KEGG Definition: MEKK and related serine/threonine protein kinases
Accession: aor:AO090023000911 Score: 635 E_value: 1e-64
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0198 Score: 185 E_value: 1e-14
PFAM Definition: Pkinase, Protein kinase domain..
Pfam Number: pfam00069 Score: 127 E_value: 5e-08
Swissprot: P41892|CDC7_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005816 = Cellular component: spindle pole body
GO:0005515 = Molecular function: protein binding
GO:0004674 = Molecular function: protein serine/threonine kinase activity
GO:0006468 = Biological process: protein amino acid phosphorylation
GO:0031028 = Biological process: septation initiation signaling

Sequence:
>Contig3742
TTGGGGTTGTTGAGCTGTTGGACGGGAAACCCCCATATCACAAACTTGCT
TCGATGCAAGCACTCTTTAGAATCGTCAATGATGATCATCCCCCGCTTCC
TGAAGGTGCCTCTCCGGCTGTCCGTGACTTCCTTATGCAGTGCTTCCAAA
AGGACCCTAATCTTCGGGTATCCGCTCGGAAGCTGCTTAAACATCCTTGG
ATTGTTACTGCTAAACGTGCGGATTCGATCGTTCGCACACCAACAACGAA
ATACGACGAAGCCGTTAAGAGTGTCCAACAGTGGAATGAAGCACTGAAGT
CACCCAATGCCGGTACCTCAAGAAAACCGCTCCGAAATCCAATCGTCAGT
CCTACACCTCGAAGATATAACAACGATTTCTCAGTTGTGGCGGTAGTTCC
CGGAAAGGGAGGCCACAGGACCTTTTCGGCATCACGCAAGACTGAGGCCT
TTATGTCGCCCGAAAATAATGATGATGACGACGACAATTGGGACGATGAC
TTTGCTTCAGTTATATCACCTAGTGCCCTTCAGCTTCCTCGCAACAGGGC
TCCAGAAAATCGACATTTGGGAGTTGTGCAATCATCTGAACGTCTCAAGT
CTTTTTCATCCCATGATGGGGTTAATGAGAGCTGGGACGACAATTTTGAG
GGCGATCTTACGATCAAGAGCCCTCCATTGATGTCTGATTTAGTGATGTC
TGATTTTGATGAAGACGCTATGCAAACTATTCGACCCTATTTCCCCCGGC
GCCAGAGCGAACCCGGTCTTGAATTTGATCATGATACACCCAGCCCTCCC
ATGATTCCTATCAGAGAGAAACAACCCATGCCGCCACCTCACCCCCTTCC
TCCAGTGTTATCGCCATCTCCCACAAAGTTGTTGAGGAAGCTTGTGCTTC
CGTCCCGACATGTCTCTCACCCGGCTTCGATTTTTAAGGAGAATTCCTTT
GAAGATTATTCTGATCTAGCACCACTAAATGAAGCTAGCTTTGCCAAGAA
GGTTGATCTTATGAAGAAGGATGCCTCCTTGAGTCCACGGCTATTCCACC
CATC

Sequences in the Contig:

SY0AAB54YG22FM1 SY0AAC15YC10FM1 SY0AAC29YG22FM1